\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308497271:

Variant ID: vg0308497271 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8497271
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CATGGGCCCCACATGTCACTCAAACTCACCCTTCCTCTTCTTCCTCCTCTCTCCCCATCTCCCTCTCTTCATCTCTCTCCCCTCTCCTCTCCTCTTCCGG[T/C]
GAGAGTGGCGAGTTGGAGGGGGGCGGCGAGACCGGCGCCCACCGGTGAGAGCAGCAAGTTGGAGGAGAAAGCCGGGGTGATAAAAGGGGATCGGCGACGG

Reverse complement sequence

CCGTCGCCGATCCCCTTTTATCACCCCGGCTTTCTCCTCCAACTTGCTGCTCTCACCGGTGGGCGCCGGTCTCGCCGCCCCCCTCCAACTCGCCACTCTC[A/G]
CCGGAAGAGGAGAGGAGAGGGGAGAGAGATGAAGAGAGGGAGATGGGGAGAGAGGAGGAAGAAGAGGAAGGGTGAGTTTGAGTGACATGTGGGGCCCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 33.20% 0.66% 2.14% NA
All Indica  2759 92.40% 3.00% 1.05% 3.52% NA
All Japonica  1512 4.80% 95.00% 0.00% 0.13% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 92.90% 2.00% 1.85% 3.19% NA
Indica II  465 84.30% 2.20% 1.94% 11.61% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 91.00% 4.80% 1.15% 3.05% NA
Temperate Japonica  767 1.60% 98.20% 0.00% 0.26% NA
Tropical Japonica  504 10.70% 89.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 52.20% 43.30% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308497271 T -> C LOC_Os03g15470.1 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:50.813; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg0308497271 T -> C LOC_Os03g15480.1 upstream_gene_variant ; 4093.0bp to feature; MODIFIER silent_mutation Average:50.813; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg0308497271 T -> C LOC_Os03g15460-LOC_Os03g15470 intergenic_region ; MODIFIER silent_mutation Average:50.813; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg0308497271 T -> DEL N N silent_mutation Average:50.813; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308497271 NA 1.22E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 2.02E-45 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 9.01E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 9.51E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 1.19E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 1.79E-30 mr1631 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 6.72E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 2.86E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 8.03E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 1.48E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 1.78E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 8.66E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 2.46E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 5.46E-31 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 7.89E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 5.48E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 4.76E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308497271 NA 9.42E-52 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251