Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308275054:

Variant ID: vg0308275054 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8275054
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTTCTGCTACCTTGTAGATCACCGATCTATAGGATTTGTTCACATGCACTGGCTTTTTTTTGAGTCCTCTGTTCTTCTTTTTTGCCGGCCGGAAGTT[C/A]
CGGTGTTCTTGCACCCGGAACCTCTGGGCGCTGTCCAGCCAGCCTGTCATTCTTACTTCTCTTAATTTTTGCCTAACTACTGCACTCCAAATTGTTGATT

Reverse complement sequence

AATCAACAATTTGGAGTGCAGTAGTTAGGCAAAAATTAAGAGAAGTAAGAATGACAGGCTGGCTGGACAGCGCCCAGAGGTTCCGGGTGCAAGAACACCG[G/T]
AACTTCCGGCCGGCAAAAAAGAAGAACAGAGGACTCAAAAAAAAGCCAGTGCATGTGAACAAATCCTATAGATCGGTGATCTACAAGGTAGCAGAAACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.50%	11.30%	1.23%	6.98%	NA
All Indica	2759	79.40%	18.10%	0.80%	1.67%	NA
All Japonica	1512	98.80%	1.10%	0.07%	0.07%	NA
Aus	269	11.20%	0.00%	9.29%	79.55%	NA
Indica I	595	86.70%	12.80%	0.34%	0.17%	NA
Indica II	465	37.00%	60.00%	1.94%	1.08%	NA
Indica III	913	97.60%	0.80%	0.33%	1.31%	NA
Indica Intermediate	786	77.90%	17.60%	1.02%	3.56%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.80%	0.41%	0.41%	NA
VI/Aromatic	96	29.20%	0.00%	9.38%	61.46%	NA
Intermediate	90	70.00%	17.80%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308275054	C -> A	LOC_Os03g15150.1	upstream_gene_variant ; 119.0bp to feature; MODIFIER	silent_mutation	Average:36.571; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0308275054	C -> A	LOC_Os03g15140.1	downstream_gene_variant ; 1173.0bp to feature; MODIFIER	silent_mutation	Average:36.571; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0308275054	C -> A	LOC_Os03g15140-LOC_Os03g15150	intergenic_region ; MODIFIER	silent_mutation	Average:36.571; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0308275054	C -> DEL	N	N	silent_mutation	Average:36.571; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308275054	NA	6.26E-06	mr1520	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308275054	NA	1.38E-10	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308275054	NA	5.86E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308275054	5.82E-06	NA	mr1497_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308275054	NA	3.82E-09	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251