\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308275054:

Variant ID: vg0308275054 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8275054
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTTCTGCTACCTTGTAGATCACCGATCTATAGGATTTGTTCACATGCACTGGCTTTTTTTTGAGTCCTCTGTTCTTCTTTTTTGCCGGCCGGAAGTT[C/A]
CGGTGTTCTTGCACCCGGAACCTCTGGGCGCTGTCCAGCCAGCCTGTCATTCTTACTTCTCTTAATTTTTGCCTAACTACTGCACTCCAAATTGTTGATT

Reverse complement sequence

AATCAACAATTTGGAGTGCAGTAGTTAGGCAAAAATTAAGAGAAGTAAGAATGACAGGCTGGCTGGACAGCGCCCAGAGGTTCCGGGTGCAAGAACACCG[G/T]
AACTTCCGGCCGGCAAAAAAGAAGAACAGAGGACTCAAAAAAAAGCCAGTGCATGTGAACAAATCCTATAGATCGGTGATCTACAAGGTAGCAGAAACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.50% 11.30% 1.23% 6.98% NA
All Indica  2759 79.40% 18.10% 0.80% 1.67% NA
All Japonica  1512 98.80% 1.10% 0.07% 0.07% NA
Aus  269 11.20% 0.00% 9.29% 79.55% NA
Indica I  595 86.70% 12.80% 0.34% 0.17% NA
Indica II  465 37.00% 60.00% 1.94% 1.08% NA
Indica III  913 97.60% 0.80% 0.33% 1.31% NA
Indica Intermediate  786 77.90% 17.60% 1.02% 3.56% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.41% 0.41% NA
VI/Aromatic  96 29.20% 0.00% 9.38% 61.46% NA
Intermediate  90 70.00% 17.80% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308275054 C -> A LOC_Os03g15150.1 upstream_gene_variant ; 119.0bp to feature; MODIFIER silent_mutation Average:36.571; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0308275054 C -> A LOC_Os03g15140.1 downstream_gene_variant ; 1173.0bp to feature; MODIFIER silent_mutation Average:36.571; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0308275054 C -> A LOC_Os03g15140-LOC_Os03g15150 intergenic_region ; MODIFIER silent_mutation Average:36.571; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0308275054 C -> DEL N N silent_mutation Average:36.571; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308275054 NA 6.26E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308275054 NA 1.38E-10 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308275054 NA 5.86E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308275054 5.82E-06 NA mr1497_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308275054 NA 3.82E-09 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251