\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308157789:

Variant ID: vg0308157789 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8157789
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ACGTTGTGCCGCGTGGGTTCCATTTCGCTATGCTCCATATATCCATAATATGGTTGTGTTTGGATCCAAACTTCAGTTCTTTTCTATCACATTAATCTGT[T/C]
ATACACACAACTTTGCAGTCACATCATATCCAATTTCAACCAAAATTTAAACTTTACGCTGAACTAAACGCAGCCTATATCCACAGAGGCATTCTCTCCC

Reverse complement sequence

GGGAGAGAATGCCTCTGTGGATATAGGCTGCGTTTAGTTCAGCGTAAAGTTTAAATTTTGGTTGAAATTGGATATGATGTGACTGCAAAGTTGTGTGTAT[A/G]
ACAGATTAATGTGATAGAAAAGAACTGAAGTTTGGATCCAAACACAACCATATTATGGATATATGGAGCATAGCGAAATGGAACCCACGCGGCACAACGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 24.40% 0.04% 0.00% NA
All Indica  2759 93.40% 6.60% 0.00% 0.00% NA
All Japonica  1512 39.60% 60.40% 0.07% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 87.30% 12.70% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 30.80% 69.20% 0.00% 0.00% NA
Tropical Japonica  504 36.50% 63.50% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 25.70% 0.41% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308157789 T -> C LOC_Os03g14950.1 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:78.509; most accessible tissue: Callus, score: 99.083 N N N N
vg0308157789 T -> C LOC_Os03g14950-LOC_Os03g14980 intergenic_region ; MODIFIER silent_mutation Average:78.509; most accessible tissue: Callus, score: 99.083 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0308157789 T C 0.02 0.01 -0.01 0.06 0.05 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308157789 NA 5.56E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308157789 NA 2.65E-08 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308157789 NA 3.77E-08 mr1355_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308157789 NA 2.47E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251