\
| Variant ID: vg0308150228 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 8150228 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TATATTGGGATTTGATAAAGCAGAGATATTTTAGGTTTTTAGTTTTGTATTGGTATGTATTAAATGGATGACAAATGAATTTACTTTAGAACGGAGGTAG[T/C]
AAAAAAGATGAACAATACTTGATTTGAGTACCACCACCATGCACCCAATGTAGTATACTCTCCTACTTGTAGCTGTTTTCCTGCGATCAGGATCCTCTAC
GTAGAGGATCCTGATCGCAGGAAAACAGCTACAAGTAGGAGAGTATACTACATTGGGTGCATGGTGGTGGTACTCAAATCAAGTATTGTTCATCTTTTTT[A/G]
CTACCTCCGTTCTAAAGTAAATTCATTTGTCATCCATTTAATACATACCAATACAAAACTAAAAACCTAAAATATCTCTGCTTTATCAAATCCCAATATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.80% | 11.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 66.00% | 33.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.60% | 27.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.90% | 69.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0308150228 | T -> C | LOC_Os03g14950.1 | upstream_gene_variant ; 2316.0bp to feature; MODIFIER | silent_mutation | Average:68.456; most accessible tissue: Callus, score: 83.585 | N | N | N | N |
| vg0308150228 | T -> C | LOC_Os03g14940-LOC_Os03g14950 | intergenic_region ; MODIFIER | silent_mutation | Average:68.456; most accessible tissue: Callus, score: 83.585 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0308150228 | 2.77E-06 | NA | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308150228 | 6.62E-08 | 2.81E-10 | mr1712 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308150228 | 1.86E-06 | 2.87E-06 | mr1712 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308150228 | 9.49E-06 | NA | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308150228 | NA | 7.20E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308150228 | NA | 1.52E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |