\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308147280:

Variant ID: vg0308147280 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8147280
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTAATATTCCTTATTTTTAATTCCAAATTTTTATTATTTCCTAATTGTATTTCTATATGGACTCTATACTCCAATTCTAATATTCCTTATTTTTAATT[T/C]
CGAATTTCAGTTATTTCCTAATTGCATTTCTATATGGACTCTAGTCTCCTCTTCTAATATTCTTTATTTTTAATTTAGAATTTCAGTTATTTCCTAATTG

Reverse complement sequence

CAATTAGGAAATAACTGAAATTCTAAATTAAAAATAAAGAATATTAGAAGAGGAGACTAGAGTCCATATAGAAATGCAATTAGGAAATAACTGAAATTCG[A/G]
AATTAAAAATAAGGAATATTAGAATTGGAGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAAAAATTTGGAATTAAAAATAAGGAATATTAGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.50% 0.20% 23.74% 54.53% NA
All Indica  2759 1.60% 0.00% 17.29% 81.12% NA
All Japonica  1512 61.10% 0.50% 25.00% 13.36% NA
Aus  269 1.10% 0.00% 65.43% 33.46% NA
Indica I  595 1.30% 0.00% 6.39% 92.27% NA
Indica II  465 1.50% 0.00% 35.48% 63.01% NA
Indica III  913 1.40% 0.10% 13.36% 85.10% NA
Indica Intermediate  786 1.90% 0.00% 19.34% 78.75% NA
Temperate Japonica  767 70.10% 0.80% 18.25% 10.82% NA
Tropical Japonica  504 64.10% 0.20% 21.83% 13.89% NA
Japonica Intermediate  241 26.10% 0.40% 53.11% 20.33% NA
VI/Aromatic  96 20.80% 0.00% 66.67% 12.50% NA
Intermediate  90 31.10% 0.00% 30.00% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308147280 T -> C LOC_Os03g14930.1 downstream_gene_variant ; 3962.0bp to feature; MODIFIER silent_mutation Average:16.355; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0308147280 T -> C LOC_Os03g14940.1 downstream_gene_variant ; 2185.0bp to feature; MODIFIER silent_mutation Average:16.355; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0308147280 T -> C LOC_Os03g14940-LOC_Os03g14950 intergenic_region ; MODIFIER silent_mutation Average:16.355; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0308147280 T -> DEL N N silent_mutation Average:16.355; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308147280 NA 3.64E-09 mr1275 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251