\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308057027:

Variant ID: vg0308057027 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8057027
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGCACGGCATACTCATATGTTACCTCACCTCACGCATATATATTTTAACTCACCTCTTTAAACGTATTCCTATAAGAGAAAAAAATAATACATAAACC[C/A]
TGTGCCCAAAATAACCTAATCCTAAGATTTATCCTTAAGATTGGATTTTATTTTACTAAGGGAGTATTCACGAGAAAAAAAAACATAAGTACGATAAAAA

Reverse complement sequence

TTTTTATCGTACTTATGTTTTTTTTTCTCGTGAATACTCCCTTAGTAAAATAAAATCCAATCTTAAGGATAAATCTTAGGATTAGGTTATTTTGGGCACA[G/T]
GGTTTATGTATTATTTTTTTCTCTTATAGGAATACGTTTAAAGAGGTGAGTTAAAATATATATGCGTGAGGTGAGGTAACATATGAGTATGCCGTGCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 1.20% 4.97% 9.14% NA
All Indica  2759 79.20% 1.70% 7.18% 11.92% NA
All Japonica  1512 91.30% 0.10% 2.12% 6.48% NA
Aus  269 96.70% 2.60% 0.74% 0.00% NA
Indica I  595 84.20% 0.70% 7.06% 8.07% NA
Indica II  465 82.80% 0.90% 7.31% 9.03% NA
Indica III  913 72.10% 3.20% 7.34% 17.42% NA
Indica Intermediate  786 81.60% 1.30% 7.00% 10.18% NA
Temperate Japonica  767 97.70% 0.00% 1.04% 1.30% NA
Tropical Japonica  504 79.20% 0.40% 4.37% 16.07% NA
Japonica Intermediate  241 96.30% 0.00% 0.83% 2.90% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 94.40% 0.00% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308057027 C -> A LOC_Os03g14800.1 upstream_gene_variant ; 4480.0bp to feature; MODIFIER silent_mutation Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0308057027 C -> A LOC_Os03g14800.3 upstream_gene_variant ; 4480.0bp to feature; MODIFIER silent_mutation Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0308057027 C -> A LOC_Os03g14800.4 upstream_gene_variant ; 4460.0bp to feature; MODIFIER silent_mutation Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0308057027 C -> A LOC_Os03g14800.5 upstream_gene_variant ; 4460.0bp to feature; MODIFIER silent_mutation Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0308057027 C -> A LOC_Os03g14800.6 upstream_gene_variant ; 4460.0bp to feature; MODIFIER silent_mutation Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0308057027 C -> A LOC_Os03g14810.1 downstream_gene_variant ; 4268.0bp to feature; MODIFIER silent_mutation Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0308057027 C -> A LOC_Os03g14800-LOC_Os03g14810 intergenic_region ; MODIFIER silent_mutation Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0308057027 C -> DEL N N silent_mutation Average:32.333; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308057027 2.35E-06 2.35E-06 mr1808 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251