\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308033378:

Variant ID: vg0308033378 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8033378
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CAACAAAGTATATCAGCAGACAACGACCTCCTGCGCTGCATGTTGGCTCGCTCGGCGCCATTAGGGGTGGGCAATTTCCCCGTTGGGGCCTGGGATCCGG[C/T]
GGGGACCCGCCCCTACGGGGACGGGGGCGGGGGAGAATTCTCTTCCGCGGGTGAGTGGGGACGGGGCCCCGCAAACTTCCGAGGATGAGGACGGGGATCG

Reverse complement sequence

CGATCCCCGTCCTCATCCTCGGAAGTTTGCGGGGCCCCGTCCCCACTCACCCGCGGAAGAGAATTCTCCCCCGCCCCCGTCCCCGTAGGGGCGGGTCCCC[G/A]
CCGGATCCCAGGCCCCAACGGGGAAATTGCCCACCCCTAATGGCGCCGAGCGAGCCAACATGCAGCGCAGGAGGTCGTTGTCTGCTGATATACTTTGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.70% 0.28% 0.00% NA
All Indica  2759 28.40% 71.30% 0.33% 0.00% NA
All Japonica  1512 96.10% 3.70% 0.20% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 22.70% 76.30% 1.01% 0.00% NA
Indica II  465 8.60% 91.20% 0.22% 0.00% NA
Indica III  913 35.20% 64.80% 0.00% 0.00% NA
Indica Intermediate  786 36.60% 63.10% 0.25% 0.00% NA
Temperate Japonica  767 98.20% 1.70% 0.13% 0.00% NA
Tropical Japonica  504 91.70% 7.90% 0.40% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308033378 C -> T LOC_Os03g14770.1 upstream_gene_variant ; 2697.0bp to feature; MODIFIER silent_mutation Average:77.646; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg0308033378 C -> T LOC_Os03g14780.1 downstream_gene_variant ; 167.0bp to feature; MODIFIER silent_mutation Average:77.646; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg0308033378 C -> T LOC_Os03g14770-LOC_Os03g14780 intergenic_region ; MODIFIER silent_mutation Average:77.646; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0308033378 C T 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308033378 6.42E-07 NA Grain_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0308033378 NA 1.18E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251