\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308008402:

Variant ID: vg0308008402 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8008402
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CTACCACATCGGACAAAACCGGAGTCAAAACCGTCGAGGGACCTAGTTTGCACTGGTTTGTAAGTTGGGGAATGCGTTGTATCCAGTTTTGTGGTTCAAG[G/C]
ACAAATTTATAACGTGATAACAAGTTGAGGGGCCTTCGGTGTACTTTTTCCTTTTGCGGTCGCGCAAGCCTGGGCGGCATTTCGCATCTTGGCCCGAGCA

Reverse complement sequence

TGCTCGGGCCAAGATGCGAAATGCCGCCCAGGCTTGCGCGACCGCAAAAGGAAAAAGTACACCGAAGGCCCCTCAACTTGTTATCACGTTATAAATTTGT[C/G]
CTTGAACCACAAAACTGGATACAACGCATTCCCCAACTTACAAACCAGTGCAAACTAGGTCCCTCGACGGTTTTGACTCCGGTTTTGTCCGATGTGGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.00% 0.40% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 77.40% 21.30% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 93.50% 5.30% 1.17% 0.00% NA
Tropical Japonica  504 73.40% 26.20% 0.40% 0.00% NA
Japonica Intermediate  241 34.90% 61.80% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308008402 G -> C LOC_Os03g14720.1 upstream_gene_variant ; 113.0bp to feature; MODIFIER silent_mutation Average:59.959; most accessible tissue: Callus, score: 85.21 N N N N
vg0308008402 G -> C LOC_Os03g14730.1 downstream_gene_variant ; 2452.0bp to feature; MODIFIER silent_mutation Average:59.959; most accessible tissue: Callus, score: 85.21 N N N N
vg0308008402 G -> C LOC_Os03g14720-LOC_Os03g14730 intergenic_region ; MODIFIER silent_mutation Average:59.959; most accessible tissue: Callus, score: 85.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308008402 7.30E-06 4.65E-15 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 2.06E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 1.26E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 2.30E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 4.39E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 8.97E-08 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 4.57E-06 mr1566_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 1.20E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 8.22E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 3.91E-06 mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 6.15E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 5.63E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 4.77E-06 1.04E-12 mr1905_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402 NA 8.21E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251