Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308008402:

Variant ID: vg0308008402 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8008402
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

CTACCACATCGGACAAAACCGGAGTCAAAACCGTCGAGGGACCTAGTTTGCACTGGTTTGTAAGTTGGGGAATGCGTTGTATCCAGTTTTGTGGTTCAAG[G/C]
ACAAATTTATAACGTGATAACAAGTTGAGGGGCCTTCGGTGTACTTTTTCCTTTTGCGGTCGCGCAAGCCTGGGCGGCATTTCGCATCTTGGCCCGAGCA

Reverse complement sequence

TGCTCGGGCCAAGATGCGAAATGCCGCCCAGGCTTGCGCGACCGCAAAAGGAAAAAGTACACCGAAGGCCCCTCAACTTGTTATCACGTTATAAATTTGT[C/G]
CTTGAACCACAAAACTGGATACAACGCATTCCCCAACTTACAAACCAGTGCAAACTAGGTCCCTCGACGGTTTTGACTCCGGTTTTGTCCGATGTGGTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	7.00%	0.40%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	77.40%	21.30%	1.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	93.50%	5.30%	1.17%	0.00%	NA
Tropical Japonica	504	73.40%	26.20%	0.40%	0.00%	NA
Japonica Intermediate	241	34.90%	61.80%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308008402	G -> C	LOC_Os03g14720.1	upstream_gene_variant ; 113.0bp to feature; MODIFIER	silent_mutation	Average:59.959; most accessible tissue: Callus, score: 85.21	N	N	N	N
vg0308008402	G -> C	LOC_Os03g14730.1	downstream_gene_variant ; 2452.0bp to feature; MODIFIER	silent_mutation	Average:59.959; most accessible tissue: Callus, score: 85.21	N	N	N	N
vg0308008402	G -> C	LOC_Os03g14720-LOC_Os03g14730	intergenic_region ; MODIFIER	silent_mutation	Average:59.959; most accessible tissue: Callus, score: 85.21	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308008402	7.30E-06	4.65E-15	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	2.06E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	1.26E-06	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	2.30E-06	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	4.39E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	8.97E-08	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	4.57E-06	mr1566_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	1.20E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	8.22E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	3.91E-06	mr1849_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	6.15E-07	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	5.63E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	4.77E-06	1.04E-12	mr1905_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308008402	NA	8.21E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251