\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308007821:

Variant ID: vg0308007821 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 8007821
Reference Allele: AAlternative Allele: G,AAATCGACTCTAAAATTCATCC
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCTTGCGTGTTCCTTGGTGAGAAAATGGGGATGGCTGGTCGAGCTCGGTGACGACGCCGCGCGCACCGGCCTGCCGGCCCTTCTCCCCATGCCCCATC[A/G,AAATCGACTCTAAAATTCATCC]
TCGAGAAGATGGGGACGGCCGGTCGAGCTTGGTGACATCGCCGCTCGTGCCTGAGCGCCACCACCCAGCTCCTCCCCAGCCGGCCGCCGCCCGTGCCCGC

Reverse complement sequence

GCGGGCACGGGCGGCGGCCGGCTGGGGAGGAGCTGGGTGGTGGCGCTCAGGCACGAGCGGCGATGTCACCAAGCTCGACCGGCCGTCCCCATCTTCTCGA[T/C,GGATGAATTTTAGAGTCGATTT]
GATGGGGCATGGGGAGAAGGGCCGGCAGGCCGGTGCGCGCGGCGTCGTCACCGAGCTCGACCAGCCATCCCCATTTTCTCACCAAGGAACACGCAAGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 35.80% 0.68% 0.76% AAATCGACTCTAAAATTCATCC: 0.19%
All Indica  2759 89.90% 7.40% 1.05% 1.30% AAATCGACTCTAAAATTCATCC: 0.33%
All Japonica  1512 5.80% 94.00% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 84.40% 14.30% 0.34% 1.01% NA
Indica II  465 92.90% 2.40% 0.43% 4.30% NA
Indica III  913 90.60% 6.40% 2.19% 0.33% AAATCGACTCTAAAATTCATCC: 0.55%
Indica Intermediate  786 91.50% 6.50% 0.64% 0.89% AAATCGACTCTAAAATTCATCC: 0.51%
Temperate Japonica  767 5.10% 94.80% 0.13% 0.00% NA
Tropical Japonica  504 8.10% 91.70% 0.20% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308007821 A -> AAATCGACTCTAAAATTCATCC LOC_Os03g14720.1 5_prime_UTR_variant ; 1151.0bp to feature; MODIFIER silent_mutation Average:85.637; most accessible tissue: Zhenshan97 young leaf, score: 92.708 N N N N
vg0308007821 A -> AAATCGACTCTAAAATTCATCC LOC_Os03g14730.1 downstream_gene_variant ; 3032.0bp to feature; MODIFIER silent_mutation Average:85.637; most accessible tissue: Zhenshan97 young leaf, score: 92.708 N N N N
vg0308007821 A -> DEL N N silent_mutation Average:85.637; most accessible tissue: Zhenshan97 young leaf, score: 92.708 N N N N
vg0308007821 A -> G LOC_Os03g14720.1 5_prime_UTR_variant ; 1150.0bp to feature; MODIFIER silent_mutation Average:85.637; most accessible tissue: Zhenshan97 young leaf, score: 92.708 N N N N
vg0308007821 A -> G LOC_Os03g14730.1 downstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:85.637; most accessible tissue: Zhenshan97 young leaf, score: 92.708 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0308007821 A AAATC* -0.38 -0.09 0.01 -0.23 -0.21 -0.14
vg0308007821 A G 0.12 0.06 0.05 0.08 0.09 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308007821 NA 3.28E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 8.00E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 8.73E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 9.61E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 7.27E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 1.12E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 3.09E-06 3.09E-06 mr1250_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 1.63E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 1.36E-33 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 2.09E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 5.04E-18 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 7.32E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308007821 NA 1.46E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251