Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307974594:

Variant ID: vg0307974594 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 7974594
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGGGATAAATCACTAGTACAGATCCTTCTATCTGTGACGGGCTCTAATATGCTTAGAAATAGCGGGCCGTCACAAGGAAGTCATCTCAATCGGGCCGA[A/G]
AAGTGCCCGATTGAGATATGGTCGCACAGACATGTTAGATGGGTATAAAACTTAAGCCCGTCACGGATGACACCTATCAGTGACGGGCCACAACTTTAGG

Reverse complement sequence

CCTAAAGTTGTGGCCCGTCACTGATAGGTGTCATCCGTGACGGGCTTAAGTTTTATACCCATCTAACATGTCTGTGCGACCATATCTCAATCGGGCACTT[T/C]
TCGGCCCGATTGAGATGACTTCCTTGTGACGGCCCGCTATTTCTAAGCATATTAGAGCCCGTCACAGATAGAAGGATCTGTACTAGTGATTTATCCCATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	7.40%	0.06%	0.00%	NA
All Indica	2759	98.20%	1.70%	0.07%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	5.90%	93.70%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	97.90%	2.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.30%	3.40%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0307974594	A -> G	LOC_Os03g14669.1	downstream_gene_variant ; 2251.0bp to feature; MODIFIER	silent_mutation	Average:36.613; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0307974594	A -> G	LOC_Os03g14669.2	downstream_gene_variant ; 2251.0bp to feature; MODIFIER	silent_mutation	Average:36.613; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0307974594	A -> G	LOC_Os03g14654-LOC_Os03g14669	intergenic_region ; MODIFIER	silent_mutation	Average:36.613; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0307974594	NA	3.29E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	NA	5.08E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	NA	1.53E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	NA	2.89E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	NA	4.97E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	NA	4.27E-14	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	NA	2.89E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	NA	1.38E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	NA	7.68E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307974594	2.49E-06	NA	mr1987_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251