\
| Variant ID: vg0307967118 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7967118 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 232. )
TGAGGGATGAGTCAATTCTTTTTGGTCTTGATGATAAAAGAAATATGACTTAGAATTTAGGGTTAGAAAGGGGTGTATAGTAGTTATTCTAAAGTCACGT[C/A]
GAATTGGATATGGGTGACATAGAACCAATTCAAACACGGATAACGTACCAAAATTTTAACGAAAACATTTTCAATTTTTATAATAATAGAGATAGAGATT
AATCTCTATCTCTATTATTATAAAAATTGAAAATGTTTTCGTTAAAATTTTGGTACGTTATCCGTGTTTGAATTGGTTCTATGTCACCCATATCCAATTC[G/T]
ACGTGACTTTAGAATAACTACTATACACCCCTTTCTAACCCTAAATTCTAAGTCATATTTCTTTTATCATCAAGACCAAAAAGAATTGACTCATCCCTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 9.00% | 0.72% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 74.50% | 23.30% | 2.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 1.30% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 39.30% | 59.70% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 17.40% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307967118 | C -> A | LOC_Os03g14654.1 | upstream_gene_variant ; 1017.0bp to feature; MODIFIER | silent_mutation | Average:45.346; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg0307967118 | C -> A | LOC_Os03g14654-LOC_Os03g14669 | intergenic_region ; MODIFIER | silent_mutation | Average:45.346; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307967118 | NA | 9.32E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 8.13E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 4.31E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 3.48E-07 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 9.22E-07 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 2.77E-06 | mr1099_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 5.28E-08 | mr1222_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | 7.91E-06 | NA | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 4.82E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 1.34E-07 | mr1359_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 2.65E-07 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 1.53E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | 7.53E-06 | 2.59E-11 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 1.59E-06 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 8.60E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 8.71E-08 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 5.75E-06 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 1.25E-06 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307967118 | NA | 1.97E-07 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |