\
| Variant ID: vg0307963417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7963417 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )
GATTTCTTCCATCCTGCAAGAACCCGTCTCTGGATGCATGGAAGAGCGGGGACTCGGCAGCTCGGTTTGTTGTTGGCCTCTCTGATTTTGTGGTGATCAT[G/T]
TTTCTTTCCCTCGTTGGCTTTGTGGTTGGAGTTTTTTTTTCGTTAAGTAGCTCTCCATAACCTGTGCTAGCTCCACCCTATGTAAATTCCAACCTCTTGG
CCAAGAGGTTGGAATTTACATAGGGTGGAGCTAGCACAGGTTATGGAGAGCTACTTAACGAAAAAAAAACTCCAACCACAAAGCCAACGAGGGAAAGAAA[C/A]
ATGATCACCACAAAATCAGAGAGGCCAACAACAAACCGAGCTGCCGAGTCCCCGCTCTTCCATGCATCCAGAGACGGGTTCTTGCAGGATGGAAGAAATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 2.00% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.50% | 6.20% | 1.32% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.80% | 11.70% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307963417 | G -> T | LOC_Os03g14642.1 | upstream_gene_variant ; 3535.0bp to feature; MODIFIER | silent_mutation | Average:55.05; most accessible tissue: Callus, score: 74.621 | N | N | N | N |
| vg0307963417 | G -> T | LOC_Os03g14654.1 | downstream_gene_variant ; 1747.0bp to feature; MODIFIER | silent_mutation | Average:55.05; most accessible tissue: Callus, score: 74.621 | N | N | N | N |
| vg0307963417 | G -> T | LOC_Os03g14642-LOC_Os03g14654 | intergenic_region ; MODIFIER | silent_mutation | Average:55.05; most accessible tissue: Callus, score: 74.621 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307963417 | NA | 7.83E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | NA | 1.69E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | 7.37E-08 | 7.37E-08 | mr1409 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | NA | 1.86E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | NA | 2.59E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | NA | 8.45E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | 7.52E-06 | 7.52E-06 | mr1166_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | 6.35E-07 | 1.57E-10 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | NA | 1.01E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | NA | 4.61E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | 6.94E-06 | 7.92E-12 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307963417 | NA | 3.33E-08 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |