\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307955579:

Variant ID: vg0307955579 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7955579
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTCGCTGAAAGTATGCATGCGAAGCTGTGAAACTATCCAGGAGTCATCTCAATACTTGTGCTGAAGATCCAGTTCGATCTTAGGGATAATTGGGCCA[G/A]
GTGAATTAGCCGATTGTGTGCACACGGATGAAATGTTGAAGCAGGAAACACGCTGGTGCGGCCCATGGAACATTGCACGAGGGAGTGCAAATGTTCTGGG

Reverse complement sequence

CCCAGAACATTTGCACTCCCTCGTGCAATGTTCCATGGGCCGCACCAGCGTGTTTCCTGCTTCAACATTTCATCCGTGTGCACACAATCGGCTAATTCAC[C/T]
TGGCCCAATTATCCCTAAGATCGAACTGGATCTTCAGCACAAGTATTGAGATGACTCCTGGATAGTTTCACAGCTTCGCATGCATACTTTCAGCGAACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 14.30% 0.04% 0.00% NA
All Indica  2759 91.00% 8.90% 0.07% 0.00% NA
All Japonica  1512 94.70% 5.30% 0.00% 0.00% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 92.30% 7.70% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 92.10% 7.90% 0.00% 0.00% NA
Indica Intermediate  786 84.90% 14.90% 0.25% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 12.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307955579 G -> A LOC_Os03g14642.1 downstream_gene_variant ; 3413.0bp to feature; MODIFIER silent_mutation Average:93.566; most accessible tissue: Callus, score: 98.653 N N N N
vg0307955579 G -> A LOC_Os03g14630-LOC_Os03g14642 intergenic_region ; MODIFIER silent_mutation Average:93.566; most accessible tissue: Callus, score: 98.653 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0307955579 G A 0.02 0.02 0.0 -0.01 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307955579 NA 9.52E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307955579 NA 5.15E-08 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 4.99E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 2.11E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 2.05E-16 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 3.31E-09 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 2.33E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 4.04E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 7.64E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 1.28E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 1.72E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 4.11E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 1.07E-09 mr1522_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 6.20E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307955579 NA 1.37E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251