\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307904956:

Variant ID: vg0307904956 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7904956
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTCGAATCTTTGCAGTGTGTAGAAACACAAGAAGTACCAAAACCATTGTATCATGCTTAGAACAGAAGGTCTTTGGTTTTATAAGAACATTTGACGG[T/C]
GGATGCTCAGCGCTAAGACACCTAGGGTTGACATGGTGGACCTCGGCGCCTCGGGATTTGACACTGAGATGAAGGGTTATTTTTGTTAAATTTTTTACCA

Reverse complement sequence

TGGTAAAAAATTTAACAAAAATAACCCTTCATCTCAGTGTCAAATCCCGAGGCGCCGAGGTCCACCATGTCAACCCTAGGTGTCTTAGCGCTGAGCATCC[A/G]
CCGTCAAATGTTCTTATAAAACCAAAGACCTTCTGTTCTAAGCATGATACAATGGTTTTGGTACTTCTTGTGTTTCTACACACTGCAAAGATTCGAACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.70% 0.04% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 24.50% 75.40% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 20.60% 79.10% 0.26% 0.00% NA
Tropical Japonica  504 36.70% 63.30% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307904956 T -> C LOC_Os03g14560.1 upstream_gene_variant ; 3283.0bp to feature; MODIFIER silent_mutation Average:89.75; most accessible tissue: Minghui63 root, score: 93.716 N N N N
vg0307904956 T -> C LOC_Os03g14570.1 downstream_gene_variant ; 2037.0bp to feature; MODIFIER silent_mutation Average:89.75; most accessible tissue: Minghui63 root, score: 93.716 N N N N
vg0307904956 T -> C LOC_Os03g14570.2 downstream_gene_variant ; 1679.0bp to feature; MODIFIER silent_mutation Average:89.75; most accessible tissue: Minghui63 root, score: 93.716 N N N N
vg0307904956 T -> C LOC_Os03g14560-LOC_Os03g14570 intergenic_region ; MODIFIER silent_mutation Average:89.75; most accessible tissue: Minghui63 root, score: 93.716 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0307904956 T C 0.0 -0.01 -0.01 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307904956 NA 3.73E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 1.89E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 2.21E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 3.79E-06 5.76E-17 mr1830 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 8.56E-06 2.99E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 4.15E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 4.96E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 1.94E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 7.95E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 3.59E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 4.37E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904956 NA 9.60E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251