\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307904502:

Variant ID: vg0307904502 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7904502
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACTTTCAAGTCCAGATTTGAAAATTTTGAAAACTTCCAATTTGAGGTTTGAAAATTTTCAACTCGAGATTCGAAAACTTTCAAGTCCAGATTTGAAAA[T/A,C]
TTTGAAAAACTTTTAAATCAAGATTTGAAAACTTTCAAGTCGAGATTTAAAAACTTTCAAGTTCAAATTTGAAAAAATTTCAACTCAAAATTTAAAAACT

Reverse complement sequence

AGTTTTTAAATTTTGAGTTGAAATTTTTTCAAATTTGAACTTGAAAGTTTTTAAATCTCGACTTGAAAGTTTTCAAATCTTGATTTAAAAGTTTTTCAAA[A/T,G]
TTTTCAAATCTGGACTTGAAAGTTTTCGAATCTCGAGTTGAAAATTTTCAAACCTCAAATTGGAAGTTTTCAAAATTTTCAAATCTGGACTTGAAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.60% 3.50% 33.31% 32.54% A: 1.06%
All Indica  2759 7.00% 5.50% 37.08% 49.11% A: 1.34%
All Japonica  1512 77.20% 0.60% 17.72% 4.30% A: 0.20%
Aus  269 2.60% 0.40% 65.80% 29.00% A: 2.23%
Indica I  595 9.60% 2.20% 22.35% 65.04% A: 0.84%
Indica II  465 2.40% 2.80% 17.20% 76.56% A: 1.08%
Indica III  913 3.60% 10.00% 57.06% 27.27% A: 2.08%
Indica Intermediate  786 11.60% 4.50% 36.77% 46.18% A: 1.02%
Temperate Japonica  767 81.90% 0.10% 16.17% 1.83% NA
Tropical Japonica  504 64.30% 1.20% 25.40% 8.73% A: 0.40%
Japonica Intermediate  241 89.20% 0.80% 6.64% 2.90% A: 0.41%
VI/Aromatic  96 3.10% 3.10% 81.25% 9.38% A: 3.12%
Intermediate  90 33.30% 0.00% 31.11% 34.44% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307904502 T -> C LOC_Os03g14560.1 upstream_gene_variant ; 2829.0bp to feature; MODIFIER silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N
vg0307904502 T -> C LOC_Os03g14570.1 downstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N
vg0307904502 T -> C LOC_Os03g14570.2 downstream_gene_variant ; 2133.0bp to feature; MODIFIER silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N
vg0307904502 T -> C LOC_Os03g14560-LOC_Os03g14570 intergenic_region ; MODIFIER silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N
vg0307904502 T -> A LOC_Os03g14560.1 upstream_gene_variant ; 2829.0bp to feature; MODIFIER silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N
vg0307904502 T -> A LOC_Os03g14570.1 downstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N
vg0307904502 T -> A LOC_Os03g14570.2 downstream_gene_variant ; 2133.0bp to feature; MODIFIER silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N
vg0307904502 T -> A LOC_Os03g14560-LOC_Os03g14570 intergenic_region ; MODIFIER silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N
vg0307904502 T -> DEL N N silent_mutation Average:16.912; most accessible tissue: Callus, score: 23.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307904502 NA 1.99E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 2.54E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 4.24E-06 4.43E-07 mr1156_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 2.05E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 1.02E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 6.86E-06 1.50E-07 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 5.06E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 8.66E-06 mr1293_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 4.95E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 2.52E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 7.59E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 2.16E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 6.81E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 2.40E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 3.65E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 2.02E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 7.61E-06 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 8.85E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 3.80E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 6.31E-06 6.30E-06 mr1652_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 4.52E-20 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 7.08E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 1.17E-06 1.17E-06 mr1697_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 6.73E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 5.15E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 6.82E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 4.19E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 9.43E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307904502 NA 1.04E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251