| Variant ID: vg0307904502 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7904502 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAACTTTCAAGTCCAGATTTGAAAATTTTGAAAACTTCCAATTTGAGGTTTGAAAATTTTCAACTCGAGATTCGAAAACTTTCAAGTCCAGATTTGAAAA[T/A,C]
TTTGAAAAACTTTTAAATCAAGATTTGAAAACTTTCAAGTCGAGATTTAAAAACTTTCAAGTTCAAATTTGAAAAAATTTCAACTCAAAATTTAAAAACT
AGTTTTTAAATTTTGAGTTGAAATTTTTTCAAATTTGAACTTGAAAGTTTTTAAATCTCGACTTGAAAGTTTTCAAATCTTGATTTAAAAGTTTTTCAAA[A/T,G]
TTTTCAAATCTGGACTTGAAAGTTTTCGAATCTCGAGTTGAAAATTTTCAAACCTCAAATTGGAAGTTTTCAAAATTTTCAAATCTGGACTTGAAAGTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.60% | 3.50% | 33.31% | 32.54% | A: 1.06% |
| All Indica | 2759 | 7.00% | 5.50% | 37.08% | 49.11% | A: 1.34% |
| All Japonica | 1512 | 77.20% | 0.60% | 17.72% | 4.30% | A: 0.20% |
| Aus | 269 | 2.60% | 0.40% | 65.80% | 29.00% | A: 2.23% |
| Indica I | 595 | 9.60% | 2.20% | 22.35% | 65.04% | A: 0.84% |
| Indica II | 465 | 2.40% | 2.80% | 17.20% | 76.56% | A: 1.08% |
| Indica III | 913 | 3.60% | 10.00% | 57.06% | 27.27% | A: 2.08% |
| Indica Intermediate | 786 | 11.60% | 4.50% | 36.77% | 46.18% | A: 1.02% |
| Temperate Japonica | 767 | 81.90% | 0.10% | 16.17% | 1.83% | NA |
| Tropical Japonica | 504 | 64.30% | 1.20% | 25.40% | 8.73% | A: 0.40% |
| Japonica Intermediate | 241 | 89.20% | 0.80% | 6.64% | 2.90% | A: 0.41% |
| VI/Aromatic | 96 | 3.10% | 3.10% | 81.25% | 9.38% | A: 3.12% |
| Intermediate | 90 | 33.30% | 0.00% | 31.11% | 34.44% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307904502 | T -> C | LOC_Os03g14560.1 | upstream_gene_variant ; 2829.0bp to feature; MODIFIER | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| vg0307904502 | T -> C | LOC_Os03g14570.1 | downstream_gene_variant ; 2491.0bp to feature; MODIFIER | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| vg0307904502 | T -> C | LOC_Os03g14570.2 | downstream_gene_variant ; 2133.0bp to feature; MODIFIER | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| vg0307904502 | T -> C | LOC_Os03g14560-LOC_Os03g14570 | intergenic_region ; MODIFIER | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| vg0307904502 | T -> A | LOC_Os03g14560.1 | upstream_gene_variant ; 2829.0bp to feature; MODIFIER | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| vg0307904502 | T -> A | LOC_Os03g14570.1 | downstream_gene_variant ; 2491.0bp to feature; MODIFIER | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| vg0307904502 | T -> A | LOC_Os03g14570.2 | downstream_gene_variant ; 2133.0bp to feature; MODIFIER | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| vg0307904502 | T -> A | LOC_Os03g14560-LOC_Os03g14570 | intergenic_region ; MODIFIER | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| vg0307904502 | T -> DEL | N | N | silent_mutation | Average:16.912; most accessible tissue: Callus, score: 23.61 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307904502 | NA | 1.99E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | NA | 2.54E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | 4.24E-06 | 4.43E-07 | mr1156_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | NA | 2.05E-06 | mr1159_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | NA | 1.02E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | 6.86E-06 | 1.50E-07 | mr1186_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | NA | 5.06E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | NA | 8.66E-06 | mr1293_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | NA | 4.95E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307904502 | NA | 2.52E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/