\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307901966:

Variant ID: vg0307901966 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7901966
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGTAAAATATGAATAGTTTTTTATCTGTAATTATTTTTTAAAAAAGAAATTTCATTTTTTTTAAGTAAGACAACGACCAAACATTGAATATGGATACC[T/C]
ACGGCTACACTTATTTTAGAACAGAGGTAGTACTAGTACTCTGGCGGTCTAGCCAGCACGTTGCACGTTAATTTGCCTTTCTTGATGACTTGTCTGCATC

Reverse complement sequence

GATGCAGACAAGTCATCAAGAAAGGCAAATTAACGTGCAACGTGCTGGCTAGACCGCCAGAGTACTAGTACTACCTCTGTTCTAAAATAAGTGTAGCCGT[A/G]
GGTATCCATATTCAATGTTTGGTCGTTGTCTTACTTAAAAAAAATGAAATTTCTTTTTTAAAAAATAATTACAGATAAAAAACTATTCATATTTTACCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 18.90% 6.81% 12.61% NA
All Indica  2759 65.10% 5.30% 9.46% 20.12% NA
All Japonica  1512 47.80% 48.00% 3.37% 0.86% NA
Aus  269 94.40% 0.00% 0.00% 5.58% NA
Indica I  595 56.30% 7.90% 19.50% 16.30% NA
Indica II  465 45.40% 1.50% 15.70% 37.42% NA
Indica III  913 81.80% 1.90% 1.64% 14.68% NA
Indica Intermediate  786 64.00% 9.70% 7.25% 19.08% NA
Temperate Japonica  767 21.40% 73.90% 4.04% 0.65% NA
Tropical Japonica  504 75.60% 21.20% 2.18% 0.99% NA
Japonica Intermediate  241 73.40% 21.60% 3.73% 1.24% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 60.00% 18.90% 11.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307901966 T -> C LOC_Os03g14560.1 upstream_gene_variant ; 293.0bp to feature; MODIFIER silent_mutation Average:82.622; most accessible tissue: Callus, score: 94.98 N N N N
vg0307901966 T -> C LOC_Os03g14570.2 downstream_gene_variant ; 4669.0bp to feature; MODIFIER silent_mutation Average:82.622; most accessible tissue: Callus, score: 94.98 N N N N
vg0307901966 T -> C LOC_Os03g14560-LOC_Os03g14570 intergenic_region ; MODIFIER silent_mutation Average:82.622; most accessible tissue: Callus, score: 94.98 N N N N
vg0307901966 T -> DEL N N silent_mutation Average:82.622; most accessible tissue: Callus, score: 94.98 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0307901966 T C -0.07 0.02 0.03 0.0 -0.03 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307901966 NA 7.98E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 5.28E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 6.49E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 1.00E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 8.03E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 1.29E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 1.82E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 2.73E-07 NA mr1554_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 5.65E-06 2.50E-08 mr1554_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 5.55E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 2.75E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307901966 NA 8.77E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251