\
| Variant ID: vg0307897988 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7897988 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )
GTAGAATTATAAATAAATGTCTTTGGATTGATGCCAATTGAGAGCCAAATTTCAAATTGTGGTGAAGAACATTCTAGAATTGTGCCAAATTGAGTATAGG[C/T]
ATTACCAAATATTTGGCTTCAAACCAAATCATCACATTTACTATTTAAACTACCAAAAAATTAGTATGGCAACGTTTTGGTATCAAACCAAAACGGCCTA
TAGGCCGTTTTGGTTTGATACCAAAACGTTGCCATACTAATTTTTTGGTAGTTTAAATAGTAAATGTGATGATTTGGTTTGAAGCCAAATATTTGGTAAT[G/A]
CCTATACTCAATTTGGCACAATTCTAGAATGTTCTTCACCACAATTTGAAATTTGGCTCTCAATTGGCATCAATCCAAAGACATTTATTTATAATTCTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 3.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 5.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307897988 | C -> T | LOC_Os03g14550.1 | downstream_gene_variant ; 2105.0bp to feature; MODIFIER | silent_mutation | Average:31.393; most accessible tissue: Callus, score: 57.173 | N | N | N | N |
| vg0307897988 | C -> T | LOC_Os03g14560.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.393; most accessible tissue: Callus, score: 57.173 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307897988 | NA | 1.46E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307897988 | NA | 1.21E-06 | mr1159_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307897988 | NA | 6.65E-06 | mr1186_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307897988 | NA | 6.95E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307897988 | NA | 3.51E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307897988 | NA | 9.95E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307897988 | 8.82E-07 | 8.82E-07 | mr1697_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307897988 | NA | 5.39E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |