\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307897988:

Variant ID: vg0307897988 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7897988
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGAATTATAAATAAATGTCTTTGGATTGATGCCAATTGAGAGCCAAATTTCAAATTGTGGTGAAGAACATTCTAGAATTGTGCCAAATTGAGTATAGG[C/T]
ATTACCAAATATTTGGCTTCAAACCAAATCATCACATTTACTATTTAAACTACCAAAAAATTAGTATGGCAACGTTTTGGTATCAAACCAAAACGGCCTA

Reverse complement sequence

TAGGCCGTTTTGGTTTGATACCAAAACGTTGCCATACTAATTTTTTGGTAGTTTAAATAGTAAATGTGATGATTTGGTTTGAAGCCAAATATTTGGTAAT[G/A]
CCTATACTCAATTTGGCACAATTCTAGAATGTTCTTCACCACAATTTGAAATTTGGCTCTCAATTGGCATCAATCCAAAGACATTTATTTATAATTCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 3.10% 0.02% 0.00% NA
All Indica  2759 95.00% 5.00% 0.04% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.60% 7.40% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 98.40% 1.50% 0.11% 0.00% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307897988 C -> T LOC_Os03g14550.1 downstream_gene_variant ; 2105.0bp to feature; MODIFIER silent_mutation Average:31.393; most accessible tissue: Callus, score: 57.173 N N N N
vg0307897988 C -> T LOC_Os03g14560.1 intron_variant ; MODIFIER silent_mutation Average:31.393; most accessible tissue: Callus, score: 57.173 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307897988 NA 1.46E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307897988 NA 1.21E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307897988 NA 6.65E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307897988 NA 6.95E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307897988 NA 3.51E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307897988 NA 9.95E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307897988 8.82E-07 8.82E-07 mr1697_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307897988 NA 5.39E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251