\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307880743:

Variant ID: vg0307880743 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7880743
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCACCACACTATGGCTGTGTTCACATATGCCGGTTTCCATCCCAAACAATACGTATGAAAAACGGAGCGGTTCATTAGCACGTAATCAATTAAGTATT[C/T]
GCTATTTTTTAAAAAATGATTCAATATAATTTTTTGAGCAAATTTCGTGTAGAAACTTTTTTTAAAAAAACGTACCGGTTAACAGTTTTAAAAGCGTGCG

Reverse complement sequence

CGCACGCTTTTAAAACTGTTAACCGGTACGTTTTTTTAAAAAAAGTTTCTACACGAAATTTGCTCAAAAAATTATATTGAATCATTTTTTAAAAAATAGC[G/A]
AATACTTAATTGATTACGTGCTAATGAACCGCTCCGTTTTTCATACGTATTGTTTGGGATGGAAACCGGCATATGTGAACACAGCCATAGTGTGGTGGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 15.50% 0.13% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 52.40% 47.20% 0.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 25.90% 73.50% 0.52% 0.00% NA
Tropical Japonica  504 78.40% 21.40% 0.20% 0.00% NA
Japonica Intermediate  241 82.20% 17.40% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307880743 C -> T LOC_Os03g14520.1 upstream_gene_variant ; 497.0bp to feature; MODIFIER silent_mutation Average:55.585; most accessible tissue: Callus, score: 78.563 N N N N
vg0307880743 C -> T LOC_Os03g14530.1 upstream_gene_variant ; 4072.0bp to feature; MODIFIER silent_mutation Average:55.585; most accessible tissue: Callus, score: 78.563 N N N N
vg0307880743 C -> T LOC_Os03g14510.1 downstream_gene_variant ; 2318.0bp to feature; MODIFIER silent_mutation Average:55.585; most accessible tissue: Callus, score: 78.563 N N N N
vg0307880743 C -> T LOC_Os03g14510.2 downstream_gene_variant ; 2313.0bp to feature; MODIFIER silent_mutation Average:55.585; most accessible tissue: Callus, score: 78.563 N N N N
vg0307880743 C -> T LOC_Os03g14510-LOC_Os03g14520 intergenic_region ; MODIFIER silent_mutation Average:55.585; most accessible tissue: Callus, score: 78.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307880743 4.93E-06 NA mr1602 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743 NA 2.15E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743 NA 2.11E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743 NA 9.19E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743 NA 8.11E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743 NA 7.00E-06 mr1416_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743 3.06E-06 NA mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743 NA 9.81E-08 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743 NA 6.03E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251