| Variant ID: vg0307880743 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7880743 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGCCACCACACTATGGCTGTGTTCACATATGCCGGTTTCCATCCCAAACAATACGTATGAAAAACGGAGCGGTTCATTAGCACGTAATCAATTAAGTATT[C/T]
GCTATTTTTTAAAAAATGATTCAATATAATTTTTTGAGCAAATTTCGTGTAGAAACTTTTTTTAAAAAAACGTACCGGTTAACAGTTTTAAAAGCGTGCG
CGCACGCTTTTAAAACTGTTAACCGGTACGTTTTTTTAAAAAAAGTTTCTACACGAAATTTGCTCAAAAAATTATATTGAATCATTTTTTAAAAAATAGC[G/A]
AATACTTAATTGATTACGTGCTAATGAACCGCTCCGTTTTTCATACGTATTGTTTGGGATGGAAACCGGCATATGTGAACACAGCCATAGTGTGGTGGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 15.50% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 52.40% | 47.20% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 25.90% | 73.50% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 78.40% | 21.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.20% | 17.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307880743 | C -> T | LOC_Os03g14520.1 | upstream_gene_variant ; 497.0bp to feature; MODIFIER | silent_mutation | Average:55.585; most accessible tissue: Callus, score: 78.563 | N | N | N | N |
| vg0307880743 | C -> T | LOC_Os03g14530.1 | upstream_gene_variant ; 4072.0bp to feature; MODIFIER | silent_mutation | Average:55.585; most accessible tissue: Callus, score: 78.563 | N | N | N | N |
| vg0307880743 | C -> T | LOC_Os03g14510.1 | downstream_gene_variant ; 2318.0bp to feature; MODIFIER | silent_mutation | Average:55.585; most accessible tissue: Callus, score: 78.563 | N | N | N | N |
| vg0307880743 | C -> T | LOC_Os03g14510.2 | downstream_gene_variant ; 2313.0bp to feature; MODIFIER | silent_mutation | Average:55.585; most accessible tissue: Callus, score: 78.563 | N | N | N | N |
| vg0307880743 | C -> T | LOC_Os03g14510-LOC_Os03g14520 | intergenic_region ; MODIFIER | silent_mutation | Average:55.585; most accessible tissue: Callus, score: 78.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307880743 | 4.93E-06 | NA | mr1602 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307880743 | NA | 2.15E-06 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307880743 | NA | 2.11E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307880743 | NA | 9.19E-06 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307880743 | NA | 8.11E-06 | mr1388_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307880743 | NA | 7.00E-06 | mr1416_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307880743 | 3.06E-06 | NA | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307880743 | NA | 9.81E-08 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307880743 | NA | 6.03E-08 | mr1606_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |