Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0307880743:

Variant ID: vg0307880743 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 7880743
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCACCACACTATGGCTGTGTTCACATATGCCGGTTTCCATCCCAAACAATACGTATGAAAAACGGAGCGGTTCATTAGCACGTAATCAATTAAGTATT[C/T]
GCTATTTTTTAAAAAATGATTCAATATAATTTTTTGAGCAAATTTCGTGTAGAAACTTTTTTTAAAAAAACGTACCGGTTAACAGTTTTAAAAGCGTGCG

Reverse complement sequence

CGCACGCTTTTAAAACTGTTAACCGGTACGTTTTTTTAAAAAAAGTTTCTACACGAAATTTGCTCAAAAAATTATATTGAATCATTTTTTAAAAAATAGC[G/A]
AATACTTAATTGATTACGTGCTAATGAACCGCTCCGTTTTTCATACGTATTGTTTGGGATGGAAACCGGCATATGTGAACACAGCCATAGTGTGGTGGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	15.50%	0.13%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	52.40%	47.20%	0.40%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	25.90%	73.50%	0.52%	0.00%	NA
Tropical Japonica	504	78.40%	21.40%	0.20%	0.00%	NA
Japonica Intermediate	241	82.20%	17.40%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0307880743	C -> T	LOC_Os03g14520.1	upstream_gene_variant ; 497.0bp to feature; MODIFIER	silent_mutation	Average:55.585; most accessible tissue: Callus, score: 78.563	N	N	N	N
vg0307880743	C -> T	LOC_Os03g14530.1	upstream_gene_variant ; 4072.0bp to feature; MODIFIER	silent_mutation	Average:55.585; most accessible tissue: Callus, score: 78.563	N	N	N	N
vg0307880743	C -> T	LOC_Os03g14510.1	downstream_gene_variant ; 2318.0bp to feature; MODIFIER	silent_mutation	Average:55.585; most accessible tissue: Callus, score: 78.563	N	N	N	N
vg0307880743	C -> T	LOC_Os03g14510.2	downstream_gene_variant ; 2313.0bp to feature; MODIFIER	silent_mutation	Average:55.585; most accessible tissue: Callus, score: 78.563	N	N	N	N
vg0307880743	C -> T	LOC_Os03g14510-LOC_Os03g14520	intergenic_region ; MODIFIER	silent_mutation	Average:55.585; most accessible tissue: Callus, score: 78.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0307880743	4.93E-06	NA	mr1602	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743	NA	2.15E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743	NA	2.11E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743	NA	9.19E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743	NA	8.11E-06	mr1388_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743	NA	7.00E-06	mr1416_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743	3.06E-06	NA	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743	NA	9.81E-08	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307880743	NA	6.03E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251