Variant ID: vg0307865773 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 7865773 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGATCCAAGAGAGAAATTTCCTTGGATCACGGAACAGGTCTGGGAGGAATTCCATGTGAAGAAGTCGACCCCCGAGTCCAGAGCTAGTAGCGAGGCATAT[C/T]
GCTTGCTCTAGACCAAGAACCAGCATCCGCATCGGTTTGGCACCGCTGAATATGCCGGTAAGAAAGAGGAATGGCAGCGTGAGGATGAAGAAGCGGAGGA
TCCTCCGCTTCTTCATCCTCACGCTGCCATTCCTCTTTCTTACCGGCATATTCAGCGGTGCCAAACCGATGCGGATGCTGGTTCTTGGTCTAGAGCAAGC[G/A]
ATATGCCTCGCTACTAGCTCTGGACTCGGGGGTCGACTTCTTCACATGGAATTCCTCCCAGACCTGTTCCGTGATCCAAGGAAATTTCTCTCTTGGATCT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.70% | 9.00% | 0.28% | 0.00% | NA |
All Indica | 2759 | 93.60% | 6.10% | 0.29% | 0.00% | NA |
All Japonica | 1512 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Aus | 269 | 19.00% | 79.20% | 1.86% | 0.00% | NA |
Indica I | 595 | 92.30% | 7.40% | 0.34% | 0.00% | NA |
Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica III | 913 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 88.20% | 11.10% | 0.76% | 0.00% | NA |
Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0307865773 | C -> T | LOC_Os03g14480.1 | upstream_gene_variant ; 995.0bp to feature; MODIFIER | silent_mutation | Average:29.873; most accessible tissue: Callus, score: 43.216 | N | N | N | N |
vg0307865773 | C -> T | LOC_Os03g14470.1 | downstream_gene_variant ; 3188.0bp to feature; MODIFIER | silent_mutation | Average:29.873; most accessible tissue: Callus, score: 43.216 | N | N | N | N |
vg0307865773 | C -> T | LOC_Os03g14490.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.873; most accessible tissue: Callus, score: 43.216 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0307865773 | NA | 5.86E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307865773 | NA | 1.11E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307865773 | NA | 3.11E-11 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307865773 | 3.72E-06 | 2.64E-06 | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307865773 | NA | 4.65E-18 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |