Search for Variation information by Variation ID:
Detailed information for vg0307861794:
| Variant ID: vg0307861794 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7861794 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AGGTTACACGACTGAGGAGGCTATTGAGTTCTGTGTCAATTACATGTCCGATGCCGATCCTATCGGAGTTCCTGCGTCTCATCACGGGGGAAGGTTGTCA[G/A,C]
GTGTTGGCACAATCGGAAGGAAAAGAATTAGGCCAGATCAAGTGTCGTATGCGCAGGCTCATTACGCTGTGCTCCAGCATATGGCAGAAGTTGGCCCATA
Reverse complement sequence
TATGGGCCAACTTCTGCCATATGCTGGAGCACAGCGTAATGAGCCTGCGCATACGACACTTGATCTGGCCTAATTCTTTTCCTTCCGATTGTGCCAACAC[C/T,G]
TGACAACCTTCCCCCGTGATGAGACGCAGGAACTCCGATAGGATCGGCATCGGACATGTAATTGACACAGAACTCAATAGCCTCCTCAGTCGTGTAACCT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.30% | 0.10% | 10.26% | 41.18% | C: 0.08% |
| All Indica | 2759 | 35.60% | 0.20% | 9.86% | 54.33% | C: 0.04% |
| All Japonica | 1512 | 81.30% | 0.00% | 5.82% | 12.90% | NA |
| Aus | 269 | 7.80% | 0.70% | 34.20% | 56.13% | C: 1.12% |
| Indica I | 595 | 13.90% | 0.00% | 12.77% | 73.28% | NA |
| Indica II | 465 | 23.00% | 0.00% | 9.03% | 67.96% | NA |
| Indica III | 913 | 58.60% | 0.10% | 7.67% | 33.52% | C: 0.11% |
| Indica Intermediate | 786 | 32.70% | 0.50% | 10.69% | 56.11% | NA |
| Temperate Japonica | 767 | 88.00% | 0.00% | 9.91% | 2.09% | NA |
| Tropical Japonica | 504 | 67.90% | 0.00% | 1.19% | 30.95% | NA |
| Japonica Intermediate | 241 | 88.00% | 0.00% | 2.49% | 9.54% | NA |
| VI/Aromatic | 96 | 10.40% | 0.00% | 27.08% | 62.50% | NA |
| Intermediate | 90 | 46.70% | 0.00% | 7.78% | 45.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307861794 | G -> C | LOC_Os03g14470.1 | missense_variant ; p.Gly253Arg; MODERATE | nonsynonymous_codon ; G253R | Average:16.091; most accessible tissue: Zhenshan97 panicle, score: 32.308 | benign  |
0.767 |
DELETERIOUS | 0.04 |
| vg0307861794 | G -> A | LOC_Os03g14470.1 | missense_variant ; p.Gly253Ser; MODERATE | nonsynonymous_codon ; G253S | Average:16.091; most accessible tissue: Zhenshan97 panicle, score: 32.308 | possibly damaging |
1.716 |
DELETERIOUS | 0.04 |
| vg0307861794 | G -> DEL | LOC_Os03g14470.1 | N | frameshift_variant | Average:16.091; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307861794 | NA | 2.43E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 7.61E-07 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | 1.04E-06 | 2.89E-08 | mr1107 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 1.68E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 5.93E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 4.28E-09 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 5.58E-08 | mr1888 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 5.73E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 4.29E-06 | mr1260_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 2.78E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307861794 | NA | 1.30E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |