\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307814706:

Variant ID: vg0307814706 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7814706
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, T: 0.20, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGAGAGCATAATAGCAGAACCTCTATTTTCCCTACTTATATCTATAAATTACATGTAAACACTCCACTGGTTTGGCAAACAAGGTAGCAGCTGAACAC[A/T]
AGAAAGAACAATCTGAAAAGGGAAAAGTGGGTGACAGGTGGCCACCAGGGATGGGCCAGTGAAGCTGTCTCTCTTCCCCAATCGAGCCGCTTTCCCCTGT

Reverse complement sequence

ACAGGGGAAAGCGGCTCGATTGGGGAAGAGAGACAGCTTCACTGGCCCATCCCTGGTGGCCACCTGTCACCCACTTTTCCCTTTTCAGATTGTTCTTTCT[T/A]
GTGTTCAGCTGCTACCTTGTTTGCCAAACCAGTGGAGTGTTTACATGTAATTTATAGATATAAGTAGGGAAAATAGAGGTTCTGCTATTATGCTCTCTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.80% 0.08% 0.00% NA
All Indica  2759 93.00% 6.80% 0.14% 0.00% NA
All Japonica  1512 15.70% 84.30% 0.00% 0.00% NA
Aus  269 17.80% 82.20% 0.00% 0.00% NA
Indica I  595 91.80% 7.90% 0.34% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.20% 0.25% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 36.30% 63.70% 0.00% 0.00% NA
Japonica Intermediate  241 15.40% 84.60% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307814706 A -> T LOC_Os03g14349.1 upstream_gene_variant ; 4887.0bp to feature; MODIFIER silent_mutation Average:99.149; most accessible tissue: Zhenshan97 flower, score: 99.839 N N N N
vg0307814706 A -> T LOC_Os03g14370.1 upstream_gene_variant ; 315.0bp to feature; MODIFIER silent_mutation Average:99.149; most accessible tissue: Zhenshan97 flower, score: 99.839 N N N N
vg0307814706 A -> T LOC_Os03g14370.2 upstream_gene_variant ; 315.0bp to feature; MODIFIER silent_mutation Average:99.149; most accessible tissue: Zhenshan97 flower, score: 99.839 N N N N
vg0307814706 A -> T LOC_Os03g14349-LOC_Os03g14370 intergenic_region ; MODIFIER silent_mutation Average:99.149; most accessible tissue: Zhenshan97 flower, score: 99.839 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0307814706 A T -0.02 -0.03 -0.02 0.03 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307814706 NA 5.54E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 1.88E-39 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 1.70E-38 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 1.40E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 3.02E-22 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 5.82E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 5.52E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 1.01E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 8.58E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 5.74E-09 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 8.93E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 5.70E-34 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 3.56E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 4.85E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 4.56E-06 4.55E-06 mr1877 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 1.19E-18 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 1.51E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 2.15E-19 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 4.91E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 3.13E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307814706 NA 2.77E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251