\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307804168:

Variant ID: vg0307804168 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7804168
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, G: 0.36, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGAACTGCCTCCGTTGGCATTGTTGTTCGCGGCACCGGCTCCAGCTCCTGGCGCACCACCTCCAGCTCCAGCTCCAGGTGGCGCACCACTTCCGCCAT[C/G]
TCCTCCAGCAGCAGCAGCGGCGCCAGCTCCAGGCGCAGACATGGTGGGCGAGGACGAGGACGAGCAGTCGTGCGGGAAGCACTCCCCAAAAACCTGATCA

Reverse complement sequence

TGATCAGGTTTTTGGGGAGTGCTTCCCGCACGACTGCTCGTCCTCGTCCTCGCCCACCATGTCTGCGCCTGGAGCTGGCGCCGCTGCTGCTGCTGGAGGA[G/C]
ATGGCGGAAGTGGTGCGCCACCTGGAGCTGGAGCTGGAGGTGGTGCGCCAGGAGCTGGAGCCGGTGCCGCGAACAACAATGCCAACGGAGGCAGTTCTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 27.40% 0.11% 0.00% NA
All Indica  2759 99.70% 0.20% 0.07% 0.00% NA
All Japonica  1512 16.60% 83.40% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.25% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 36.30% 63.70% 0.00% 0.00% NA
Japonica Intermediate  241 17.00% 83.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 30.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307804168 C -> G LOC_Os03g14334.1 downstream_gene_variant ; 2306.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0307804168 C -> G LOC_Os03g14349.1 downstream_gene_variant ; 1292.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0307804168 C -> G LOC_Os03g14334.2 downstream_gene_variant ; 2306.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0307804168 C -> G LOC_Os03g14334-LOC_Os03g14349 intergenic_region ; MODIFIER silent_mutation Average:61.757; most accessible tissue: Minghui63 root, score: 74.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307804168 3.63E-07 1.68E-49 mr1136 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 NA 4.06E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 5.64E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 4.04E-06 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 NA 4.93E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 NA 1.70E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 9.74E-07 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 6.10E-06 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 NA 9.77E-36 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 NA 3.70E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 NA 8.05E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 NA 4.23E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307804168 NA 2.22E-17 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251