\
| Variant ID: vg0307804168 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7804168 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, G: 0.36, others allele: 0.00, population size: 90. )
GCAGAACTGCCTCCGTTGGCATTGTTGTTCGCGGCACCGGCTCCAGCTCCTGGCGCACCACCTCCAGCTCCAGCTCCAGGTGGCGCACCACTTCCGCCAT[C/G]
TCCTCCAGCAGCAGCAGCGGCGCCAGCTCCAGGCGCAGACATGGTGGGCGAGGACGAGGACGAGCAGTCGTGCGGGAAGCACTCCCCAAAAACCTGATCA
TGATCAGGTTTTTGGGGAGTGCTTCCCGCACGACTGCTCGTCCTCGTCCTCGCCCACCATGTCTGCGCCTGGAGCTGGCGCCGCTGCTGCTGCTGGAGGA[G/C]
ATGGCGGAAGTGGTGCGCCACCTGGAGCTGGAGCTGGAGGTGGTGCGCCAGGAGCTGGAGCCGGTGCCGCGAACAACAATGCCAACGGAGGCAGTTCTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.50% | 27.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 16.60% | 83.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.50% | 96.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.30% | 63.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.00% | 83.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 30.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307804168 | C -> G | LOC_Os03g14334.1 | downstream_gene_variant ; 2306.0bp to feature; MODIFIER | silent_mutation | Average:61.757; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0307804168 | C -> G | LOC_Os03g14349.1 | downstream_gene_variant ; 1292.0bp to feature; MODIFIER | silent_mutation | Average:61.757; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0307804168 | C -> G | LOC_Os03g14334.2 | downstream_gene_variant ; 2306.0bp to feature; MODIFIER | silent_mutation | Average:61.757; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0307804168 | C -> G | LOC_Os03g14334-LOC_Os03g14349 | intergenic_region ; MODIFIER | silent_mutation | Average:61.757; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307804168 | 3.63E-07 | 1.68E-49 | mr1136 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | NA | 4.06E-29 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | 5.64E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | 4.04E-06 | NA | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | NA | 4.93E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | NA | 1.70E-27 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | 9.74E-07 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | 6.10E-06 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | NA | 9.77E-36 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | NA | 3.70E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | NA | 8.05E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | NA | 4.23E-21 | mr1175_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307804168 | NA | 2.22E-17 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |