\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307749732:

Variant ID: vg0307749732 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7749732
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTAATGCTCCACGCATGTGTTCAAACATTTAATGTGACGTTTTTTGCCAAAATTTTTTGGGATCTAAACAAGGCCTTAGGCCGAGTTTAGTTCCAAA[A/T]
TTTTTCTTCAAACTTTCAACTTTTCCATAATATCAAAACTTTCCAACACACACAAACTTTTAACTTTTCCATCACATTATTTCAATTTCAACCAAACTTT

Reverse complement sequence

AAAGTTTGGTTGAAATTGAAATAATGTGATGGAAAAGTTAAAAGTTTGTGTGTGTTGGAAAGTTTTGATATTATGGAAAAGTTGAAAGTTTGAAGAAAAA[T/A]
TTTGGAACTAAACTCGGCCTAAGGCCTTGTTTAGATCCCAAAAAATTTTGGCAAAAAACGTCACATTAAATGTTTGAACACATGCGTGGAGCATTAAATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 11.00% 0.06% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 66.30% 33.50% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 93.20% 6.80% 0.00% 0.00% NA
Tropical Japonica  504 42.70% 57.10% 0.20% 0.00% NA
Japonica Intermediate  241 30.30% 69.30% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307749732 A -> T LOC_Os03g14258.1 upstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:73.181; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N
vg0307749732 A -> T LOC_Os03g14250.1 downstream_gene_variant ; 363.0bp to feature; MODIFIER silent_mutation Average:73.181; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N
vg0307749732 A -> T LOC_Os03g14254.1 downstream_gene_variant ; 796.0bp to feature; MODIFIER silent_mutation Average:73.181; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N
vg0307749732 A -> T LOC_Os03g14260.1 downstream_gene_variant ; 4963.0bp to feature; MODIFIER silent_mutation Average:73.181; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N
vg0307749732 A -> T LOC_Os03g14260.2 downstream_gene_variant ; 3354.0bp to feature; MODIFIER silent_mutation Average:73.181; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N
vg0307749732 A -> T LOC_Os03g14250-LOC_Os03g14254 intergenic_region ; MODIFIER silent_mutation Average:73.181; most accessible tissue: Minghui63 young leaf, score: 93.565 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0307749732 A T -0.01 0.0 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307749732 NA 1.58E-11 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 1.32E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 4.58E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 8.99E-07 1.69E-18 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 8.75E-08 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 3.95E-08 1.23E-27 mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 9.39E-10 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 1.08E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 8.46E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 4.30E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 1.05E-10 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 1.27E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 3.06E-08 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 2.56E-11 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 2.25E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 3.37E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 2.23E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 1.06E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 2.86E-06 6.13E-19 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 1.24E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 3.96E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 2.52E-09 4.75E-32 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307749732 NA 5.95E-12 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251