\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307653172:

Variant ID: vg0307653172 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7653172
Reference Allele: AAlternative Allele: T,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.21, A: 0.01, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCGCCTTTGAACGATAATATTAATAGCATTATTGCTAGAGAAAATATTGATAGTTTACAACTCTAATATGGCTAATTACAGTACAAAACTATAAATG[A/T,C]
TACAAGTCAATTATATGGGCTCCGTTGGATACCCGTTACCCGTATGGATGTGGGTATGGGGACGATTTTATACTGGCGACGGGTGTGGATATTTAAGTTG

Reverse complement sequence

CAACTTAAATATCCACACCCGTCGCCAGTATAAAATCGTCCCCATACCCACATCCATACGGGTAACGGGTATCCAACGGAGCCCATATAATTGACTTGTA[T/A,G]
CATTTATAGTTTTGTACTGTAATTAGCCATATTAGAGTTGTAAACTATCAATATTTTCTCTAGCAATAATGCTATTAATATTATCGTTCAAAGGCGAGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 27.40% 0.08% 0.00% C: 0.89%
All Indica  2759 99.10% 0.30% 0.04% 0.00% C: 0.58%
All Japonica  1512 17.00% 82.70% 0.07% 0.00% C: 0.20%
Aus  269 98.50% 0.40% 0.00% 0.00% C: 1.12%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.20% 0.10% 0.11% 0.00% C: 0.55%
Indica Intermediate  786 98.00% 0.60% 0.00% 0.00% C: 1.40%
Temperate Japonica  767 19.90% 80.10% 0.00% 0.00% NA
Tropical Japonica  504 18.70% 81.00% 0.20% 0.00% C: 0.20%
Japonica Intermediate  241 4.10% 95.00% 0.00% 0.00% C: 0.83%
VI/Aromatic  96 78.10% 4.20% 0.00% 0.00% C: 17.71%
Intermediate  90 61.10% 33.30% 2.22% 0.00% C: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307653172 A -> T LOC_Os03g14080.1 downstream_gene_variant ; 2613.0bp to feature; MODIFIER silent_mutation Average:47.631; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0307653172 A -> T LOC_Os03g14090.1 downstream_gene_variant ; 3010.0bp to feature; MODIFIER silent_mutation Average:47.631; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0307653172 A -> T LOC_Os03g14080-LOC_Os03g14090 intergenic_region ; MODIFIER silent_mutation Average:47.631; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0307653172 A -> C LOC_Os03g14080.1 downstream_gene_variant ; 2613.0bp to feature; MODIFIER silent_mutation Average:47.631; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0307653172 A -> C LOC_Os03g14090.1 downstream_gene_variant ; 3010.0bp to feature; MODIFIER silent_mutation Average:47.631; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0307653172 A -> C LOC_Os03g14080-LOC_Os03g14090 intergenic_region ; MODIFIER silent_mutation Average:47.631; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307653172 NA 1.63E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307653172 NA 3.76E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 9.87E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 1.81E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 9.81E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 5.78E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 3.37E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 9.34E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 2.38E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 2.83E-06 2.83E-06 mr1384 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 5.36E-07 NA mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 6.22E-06 NA mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 3.70E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 2.52E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 1.17E-27 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 1.90E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 2.67E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 2.97E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 3.89E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 2.57E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 1.81E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 6.64E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 1.16E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 8.21E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 1.09E-17 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 2.69E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 6.06E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307653172 NA 1.34E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251