Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307590023:

Variant ID: vg0307590023 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 7590023
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGCCAGGTGGGTGAGGCGAAGGGTGCAGGGGCCGAAGCCCGTTGCCGACCACATGTACCACATGGGTGTCATGGCGGAGGTAGGTGGGCGGCGGCGGC[G/A]
GCGTATTGCGACCGGGACTCCTCCGTTGCTTCCTCTCGCTCGGCCGGCCTCCTTCCTCTTCGTCACGGCGGCCACCACCCTATCACCACCTTTGTCCACA

Reverse complement sequence

TGTGGACAAAGGTGGTGATAGGGTGGTGGCCGCCGTGACGAAGAGGAAGGAGGCCGGCCGAGCGAGAGGAAGCAACGGAGGAGTCCCGGTCGCAATACGC[C/T]
GCCGCCGCCGCCCACCTACCTCCGCCATGACACCCATGTGGTACATGTGGTCGGCAACGGGCTTCGGCCCCTGCACCCTTCGCCTCACCCACCTGGCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	6.90%	0.13%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	78.40%	21.20%	0.40%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	95.40%	4.60%	0.00%	0.00%	NA
Tropical Japonica	504	71.00%	28.40%	0.60%	0.00%	NA
Japonica Intermediate	241	39.40%	59.30%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0307590023	G -> A	LOC_Os03g13984.1	upstream_gene_variant ; 244.0bp to feature; MODIFIER	silent_mutation	Average:76.01; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0307590023	G -> A	LOC_Os03g14000.1	upstream_gene_variant ; 1845.0bp to feature; MODIFIER	silent_mutation	Average:76.01; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0307590023	G -> A	LOC_Os03g14000.2	upstream_gene_variant ; 1845.0bp to feature; MODIFIER	silent_mutation	Average:76.01; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg0307590023	G -> A	LOC_Os03g13984-LOC_Os03g14000	intergenic_region ; MODIFIER	silent_mutation	Average:76.01; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0307590023	NA	3.20E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307590023	3.82E-07	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	1.33E-06	NA	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	2.02E-13	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	6.61E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	6.43E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	7.32E-11	NA	mr1238_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	2.73E-06	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	6.98E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	1.61E-10	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	7.56E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	9.16E-08	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	2.35E-06	mr1566_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	8.05E-06	8.05E-06	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	3.93E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	3.14E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	4.92E-06	NA	mr1733_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	1.31E-11	NA	mr1745_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	1.23E-06	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	1.20E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	7.71E-06	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	2.16E-07	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	NA	6.45E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307590023	2.64E-09	1.92E-18	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251