Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307490488:

Variant ID: vg0307490488 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 7490488
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGTGTTTTTCCTGTATTTTGCAATCCTCTGTTTTACACTTCAATTCCTATCAAAATCCTGTGTTTTTCCTATTCCTCAATTTTTTTTACCCTGCGATT[C/T]
AAAGGGGCTCTTAATTTTTGTTAGGGAGGCTGGACTGGCAGAGAGTGGAGACCACCTTGATTCTTCTGCGCGCGCGATGATGAGTAAAGTACAGCGTTAG

Reverse complement sequence

CTAACGCTGTACTTTACTCATCATCGCGCGCGCAGAAGAATCAAGGTGGTCTCCACTCTCTGCCAGTCCAGCCTCCCTAACAAAAATTAAGAGCCCCTTT[G/A]
AATCGCAGGGTAAAAAAAATTGAGGAATAGGAAAAACACAGGATTTTGATAGGAATTGAAGTGTAAAACAGAGGATTGCAAAATACAGGAAAAACACATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	13.20%	0.19%	0.00%	NA
All Indica	2759	79.10%	20.60%	0.33%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	87.90%	12.10%	0.00%	0.00%	NA
Indica II	465	95.70%	4.30%	0.00%	0.00%	NA
Indica III	913	68.60%	30.80%	0.66%	0.00%	NA
Indica Intermediate	786	74.90%	24.70%	0.38%	0.00%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0307490488	C -> T	LOC_Os03g13820.1	upstream_gene_variant ; 2723.0bp to feature; MODIFIER	silent_mutation	Average:71.582; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg0307490488	C -> T	LOC_Os03g13820.2	upstream_gene_variant ; 2723.0bp to feature; MODIFIER	silent_mutation	Average:71.582; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg0307490488	C -> T	LOC_Os03g13820-LOC_Os03g13830	intergenic_region ; MODIFIER	silent_mutation	Average:71.582; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0307490488	NA	5.66E-07	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	1.60E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	3.97E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	5.49E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	2.17E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	5.21E-12	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	4.93E-09	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	3.19E-06	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	1.64E-13	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	1.85E-09	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	2.50E-08	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	1.24E-11	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	1.52E-07	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	2.68E-12	mr1908_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	3.38E-08	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	2.22E-10	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488	NA	1.41E-08	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251