\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307490488:

Variant ID: vg0307490488 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7490488
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGTGTTTTTCCTGTATTTTGCAATCCTCTGTTTTACACTTCAATTCCTATCAAAATCCTGTGTTTTTCCTATTCCTCAATTTTTTTTACCCTGCGATT[C/T]
AAAGGGGCTCTTAATTTTTGTTAGGGAGGCTGGACTGGCAGAGAGTGGAGACCACCTTGATTCTTCTGCGCGCGCGATGATGAGTAAAGTACAGCGTTAG

Reverse complement sequence

CTAACGCTGTACTTTACTCATCATCGCGCGCGCAGAAGAATCAAGGTGGTCTCCACTCTCTGCCAGTCCAGCCTCCCTAACAAAAATTAAGAGCCCCTTT[G/A]
AATCGCAGGGTAAAAAAAATTGAGGAATAGGAAAAACACAGGATTTTGATAGGAATTGAAGTGTAAAACAGAGGATTGCAAAATACAGGAAAAACACATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.20% 0.19% 0.00% NA
All Indica  2759 79.10% 20.60% 0.33% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 87.90% 12.10% 0.00% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 68.60% 30.80% 0.66% 0.00% NA
Indica Intermediate  786 74.90% 24.70% 0.38% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307490488 C -> T LOC_Os03g13820.1 upstream_gene_variant ; 2723.0bp to feature; MODIFIER silent_mutation Average:71.582; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0307490488 C -> T LOC_Os03g13820.2 upstream_gene_variant ; 2723.0bp to feature; MODIFIER silent_mutation Average:71.582; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0307490488 C -> T LOC_Os03g13820-LOC_Os03g13830 intergenic_region ; MODIFIER silent_mutation Average:71.582; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307490488 NA 5.66E-07 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 1.60E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 3.97E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 5.49E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 2.17E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 5.21E-12 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 4.93E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 3.19E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 1.64E-13 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 1.85E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 2.50E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 1.24E-11 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 1.52E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 2.68E-12 mr1908_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 3.38E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 2.22E-10 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490488 NA 1.41E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251