\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307490311:

Variant ID: vg0307490311 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7490311
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTGATTCAAAGGATTGAAGCTTTCCAAATCCTATAAAATTCCTATGGAATGGCACAGTGCATGTGGATTTTGGAGGAAATTTAGCAAGAGCTCCAACC[C/T]
CTTAGAAAATTTCCTTTGAGTCTATCTCTCTCATCCGATTCCTGCGTTTTTCCTGTCCTCCAATCAAACGACCATTCATGTGTTTTTCCTGTATTTTGCA

Reverse complement sequence

TGCAAAATACAGGAAAAACACATGAATGGTCGTTTGATTGGAGGACAGGAAAAACGCAGGAATCGGATGAGAGAGATAGACTCAAAGGAAATTTTCTAAG[G/A]
GGTTGGAGCTCTTGCTAAATTTCCTCCAAAATCCACATGCACTGTGCCATTCCATAGGAATTTTATAGGATTTGGAAAGCTTCAATCCTTTGAATCAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 0.50% 1.14% 11.30% NA
All Indica  2759 79.80% 0.80% 1.88% 17.51% NA
All Japonica  1512 99.30% 0.10% 0.07% 0.60% NA
Aus  269 98.90% 0.00% 0.00% 1.12% NA
Indica I  595 87.90% 1.00% 0.34% 10.76% NA
Indica II  465 95.70% 0.60% 1.08% 2.58% NA
Indica III  913 70.10% 0.20% 1.97% 27.71% NA
Indica Intermediate  786 75.70% 1.30% 3.44% 19.59% NA
Temperate Japonica  767 98.80% 0.00% 0.13% 1.04% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 63.50% 0.00% 0.00% 36.46% NA
Intermediate  90 94.40% 0.00% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307490311 C -> T LOC_Os03g13820.1 upstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:40.721; most accessible tissue: Callus, score: 91.335 N N N N
vg0307490311 C -> T LOC_Os03g13820.2 upstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:40.721; most accessible tissue: Callus, score: 91.335 N N N N
vg0307490311 C -> T LOC_Os03g13820-LOC_Os03g13830 intergenic_region ; MODIFIER silent_mutation Average:40.721; most accessible tissue: Callus, score: 91.335 N N N N
vg0307490311 C -> DEL N N silent_mutation Average:40.721; most accessible tissue: Callus, score: 91.335 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307490311 NA 3.11E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 3.38E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 3.77E-12 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 1.36E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 1.20E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 3.04E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 1.64E-13 mr1561_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 6.75E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 2.60E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 8.65E-12 mr1875_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 5.19E-08 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 4.50E-12 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 2.38E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 2.38E-10 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307490311 NA 8.23E-09 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251