\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307401503:

Variant ID: vg0307401503 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 7401503
Reference Allele: TAGAlternative Allele: CAG,TGGGTGAGAG,T
Primary Allele: TAGSecondary Allele: CAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGATGATGCAAGTGCTCACAAATCTTCACGAAGTCAACAACAAGCACTCACACAAACTCGAATCCACAACTCTCACACACACACCAAATCCGAATCGAA[TAG/CAG,TGGGTGAGAG,T]
GGGAAACAAGAAAGCAAAGCTCAAAAGTGCTAGAGAGAGAGAGCAAGCCAAGGGCACAAATGATTGGAATGGAACCAGCAGTCCTCACAAGTGAGGGGAG

Reverse complement sequence

CTCCCCTCACTTGTGAGGACTGCTGGTTCCATTCCAATCATTTGTGCCCTTGGCTTGCTCTCTCTCTCTAGCACTTTTGAGCTTTGCTTTCTTGTTTCCC[CTA/CTG,CTCTCACCCA,A]
TTCGATTCGGATTTGGTGTGTGTGTGAGAGTTGTGGATTCGAGTTTGTGTGAGTGCTTGTTGTTGACTTCGTGAAGATTTGTGAGCACTTGCATCATCTC

Allele Frequencies:

Populations Population SizeFrequency of TAG(primary allele) Frequency of CAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.90% 5.00% 17.14% 48.82% T: 0.08%; TGGGTGAGAG: 0.02%
All Indica  2759 1.70% 3.80% 24.97% 69.41% T: 0.07%; TGGGTGAGAG: 0.04%
All Japonica  1512 84.90% 8.10% 0.26% 6.75% T: 0.07%
Aus  269 0.70% 1.50% 39.03% 58.74% NA
Indica I  595 1.20% 2.50% 14.62% 81.68% NA
Indica II  465 2.80% 1.90% 13.55% 81.29% T: 0.43%
Indica III  913 0.50% 5.60% 39.32% 54.55% NA
Indica Intermediate  786 2.70% 3.90% 22.90% 70.36% TGGGTGAGAG: 0.13%
Temperate Japonica  767 81.40% 15.40% 0.52% 2.74% NA
Tropical Japonica  504 85.10% 0.20% 0.00% 14.68% NA
Japonica Intermediate  241 95.40% 1.20% 0.00% 2.90% T: 0.41%
VI/Aromatic  96 3.10% 0.00% 4.17% 91.67% T: 1.04%
Intermediate  90 35.60% 6.70% 8.89% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307401503 TAG -> T LOC_Os03g13670.1 upstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> T LOC_Os03g13680.1 upstream_gene_variant ; 689.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> T LOC_Os03g13690.1 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> T LOC_Os03g13680-LOC_Os03g13690 intergenic_region ; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> DEL N N silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> TGGGTGAGAG LOC_Os03g13670.1 upstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> TGGGTGAGAG LOC_Os03g13680.1 upstream_gene_variant ; 689.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> TGGGTGAGAG LOC_Os03g13690.1 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> TGGGTGAGAG LOC_Os03g13680-LOC_Os03g13690 intergenic_region ; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> CAG LOC_Os03g13670.1 upstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> CAG LOC_Os03g13680.1 upstream_gene_variant ; 688.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> CAG LOC_Os03g13690.1 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N
vg0307401503 TAG -> CAG LOC_Os03g13680-LOC_Os03g13690 intergenic_region ; MODIFIER silent_mutation Average:7.53; most accessible tissue: Callus, score: 24.515 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307401503 NA 1.96E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 NA 6.56E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 NA 3.25E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 NA 1.43E-06 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 NA 1.43E-08 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 4.06E-06 2.39E-07 mr1910 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 NA 3.80E-07 mr1946 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 NA 1.73E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 NA 1.52E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307401503 NA 2.16E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251