\
| Variant ID: vg0307401503 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 7401503 |
| Reference Allele: TAG | Alternative Allele: CAG,TGGGTGAGAG,T |
| Primary Allele: TAG | Secondary Allele: CAG |
Inferred Ancestral Allele: Not determined.
GAGATGATGCAAGTGCTCACAAATCTTCACGAAGTCAACAACAAGCACTCACACAAACTCGAATCCACAACTCTCACACACACACCAAATCCGAATCGAA[TAG/CAG,TGGGTGAGAG,T]
GGGAAACAAGAAAGCAAAGCTCAAAAGTGCTAGAGAGAGAGAGCAAGCCAAGGGCACAAATGATTGGAATGGAACCAGCAGTCCTCACAAGTGAGGGGAG
CTCCCCTCACTTGTGAGGACTGCTGGTTCCATTCCAATCATTTGTGCCCTTGGCTTGCTCTCTCTCTCTAGCACTTTTGAGCTTTGCTTTCTTGTTTCCC[CTA/CTG,CTCTCACCCA,A]
TTCGATTCGGATTTGGTGTGTGTGTGAGAGTTGTGGATTCGAGTTTGTGTGAGTGCTTGTTGTTGACTTCGTGAAGATTTGTGAGCACTTGCATCATCTC
| Populations | Population Size | Frequency of TAG(primary allele) | Frequency of CAG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.90% | 5.00% | 17.14% | 48.82% | T: 0.08%; TGGGTGAGAG: 0.02% |
| All Indica | 2759 | 1.70% | 3.80% | 24.97% | 69.41% | T: 0.07%; TGGGTGAGAG: 0.04% |
| All Japonica | 1512 | 84.90% | 8.10% | 0.26% | 6.75% | T: 0.07% |
| Aus | 269 | 0.70% | 1.50% | 39.03% | 58.74% | NA |
| Indica I | 595 | 1.20% | 2.50% | 14.62% | 81.68% | NA |
| Indica II | 465 | 2.80% | 1.90% | 13.55% | 81.29% | T: 0.43% |
| Indica III | 913 | 0.50% | 5.60% | 39.32% | 54.55% | NA |
| Indica Intermediate | 786 | 2.70% | 3.90% | 22.90% | 70.36% | TGGGTGAGAG: 0.13% |
| Temperate Japonica | 767 | 81.40% | 15.40% | 0.52% | 2.74% | NA |
| Tropical Japonica | 504 | 85.10% | 0.20% | 0.00% | 14.68% | NA |
| Japonica Intermediate | 241 | 95.40% | 1.20% | 0.00% | 2.90% | T: 0.41% |
| VI/Aromatic | 96 | 3.10% | 0.00% | 4.17% | 91.67% | T: 1.04% |
| Intermediate | 90 | 35.60% | 6.70% | 8.89% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307401503 | TAG -> T | LOC_Os03g13670.1 | upstream_gene_variant ; 4578.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> T | LOC_Os03g13680.1 | upstream_gene_variant ; 689.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> T | LOC_Os03g13690.1 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> T | LOC_Os03g13680-LOC_Os03g13690 | intergenic_region ; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> DEL | N | N | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> TGGGTGAGAG | LOC_Os03g13670.1 | upstream_gene_variant ; 4578.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> TGGGTGAGAG | LOC_Os03g13680.1 | upstream_gene_variant ; 689.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> TGGGTGAGAG | LOC_Os03g13690.1 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> TGGGTGAGAG | LOC_Os03g13680-LOC_Os03g13690 | intergenic_region ; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> CAG | LOC_Os03g13670.1 | upstream_gene_variant ; 4577.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> CAG | LOC_Os03g13680.1 | upstream_gene_variant ; 688.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> CAG | LOC_Os03g13690.1 | downstream_gene_variant ; 2867.0bp to feature; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| vg0307401503 | TAG -> CAG | LOC_Os03g13680-LOC_Os03g13690 | intergenic_region ; MODIFIER | silent_mutation | Average:7.53; most accessible tissue: Callus, score: 24.515 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307401503 | NA | 1.96E-06 | mr1171 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | NA | 6.56E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | NA | 3.25E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | NA | 1.43E-06 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | NA | 1.43E-08 | mr1712 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | 4.06E-06 | 2.39E-07 | mr1910 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | NA | 3.80E-07 | mr1946 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | NA | 1.73E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | NA | 1.52E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307401503 | NA | 2.16E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |