\
| Variant ID: vg0307375905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7375905 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.26, others allele: 0.00, population size: 191. )
CAATAATTCATGCCTCCAATAATCCAGACAAACAAACAACTCGCAGCTTATTTTATATCAGCTTATTATAATCCAGCTTATAGTAATATGGTTTAATAAT[C/T]
TAGATTATAATAATCATAAGCTGAAACAAACAGGGCCTAAGTCGTGTTTAGAGCCATAATCTCTAGCCTGCTTTTTGACTGCCAATAAGGGTTTCATCGG
CCGATGAAACCCTTATTGGCAGTCAAAAAGCAGGCTAGAGATTATGGCTCTAAACACGACTTAGGCCCTGTTTGTTTCAGCTTATGATTATTATAATCTA[G/A]
ATTATTAAACCATATTACTATAAGCTGGATTATAATAAGCTGATATAAAATAAGCTGCGAGTTGTTTGTTTGTCTGGATTATTGGAGGCATGAATTATTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 7.10% | 92.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.10% | 96.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 15.10% | 84.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307375905 | C -> T | LOC_Os03g13630.1 | upstream_gene_variant ; 4035.0bp to feature; MODIFIER | silent_mutation | Average:37.74; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0307375905 | C -> T | LOC_Os03g13640.1 | upstream_gene_variant ; 4825.0bp to feature; MODIFIER | silent_mutation | Average:37.74; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0307375905 | C -> T | LOC_Os03g13630-LOC_Os03g13640 | intergenic_region ; MODIFIER | silent_mutation | Average:37.74; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307375905 | NA | 1.29E-55 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0307375905 | NA | 1.16E-73 | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 8.46E-56 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 7.60E-20 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 4.39E-102 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 7.02E-88 | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 9.92E-82 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 8.38E-46 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.81E-103 | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.43E-107 | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.66E-34 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.57E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 7.87E-98 | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.64E-36 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.41E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.21E-41 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 5.71E-23 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.99E-87 | mr1613 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.29E-27 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 4.36E-104 | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.56E-71 | mr1619 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 7.79E-74 | mr1629 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.20E-26 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 4.30E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 9.62E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.35E-49 | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.33E-59 | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.06E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.34E-87 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.37E-75 | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 8.21E-34 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.50E-22 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 4.19E-37 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.35E-72 | mr1934 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.96E-61 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 8.47E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 7.79E-71 | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.57E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | 1.91E-06 | 1.36E-125 | mr1071_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.79E-117 | mr1080_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.11E-111 | mr1100_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 4.23E-53 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 8.06E-32 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | 9.78E-06 | 2.34E-132 | mr1203_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.46E-52 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 6.39E-21 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.19E-14 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.78E-13 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.29E-18 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 8.86E-69 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 7.05E-51 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.34E-35 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.71E-30 | mr1477_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.28E-52 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 9.64E-45 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.92E-12 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.87E-60 | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.43E-143 | mr1613_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.72E-27 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.70E-115 | mr1619_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 8.08E-31 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 5.34E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.19E-21 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 7.17E-62 | mr1695_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.06E-21 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.32E-81 | mr1711_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 9.06E-17 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 5.52E-89 | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.83E-67 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.10E-35 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 6.83E-92 | mr1907_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.89E-32 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 2.84E-81 | mr1934_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 3.48E-135 | mr1962_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 6.47E-22 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 1.02E-10 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307375905 | NA | 7.45E-56 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |