Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307373114:

Variant ID: vg0307373114 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7373114
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, G: 0.22, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGTTATACGAAGGGTCTTGTCACGATTTCCCCCTTTGTAGTGCCATGGTGGTACTTCGGGGCATGGCGACATGTGTGGAATCGTGTCTTGTGGGTACA[G/T]
TTGTACACCTCTGACCAGAGTAAAACTATTTGAATAACCGTGCCCGCGGTTATGGGCGATCAACCAGATTCACCGTGATTAGTCTCACCCCTAGTTTAGC

Reverse complement sequence

GCTAAACTAGGGGTGAGACTAATCACGGTGAATCTGGTTGATCGCCCATAACCGCGGGCACGGTTATTCAAATAGTTTTACTCTGGTCAGAGGTGTACAA[C/A]
TGTACCCACAAGACACGATTCCACACATGTCGCCATGCCCCGAAGTACCACCATGGCACTACAAAGGGGGAAATCGTGACAAGACCCTTCGTATAACCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.80% 0.04% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 7.10% 92.80% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 3.10% 96.70% 0.13% 0.00% NA
Tropical Japonica  504 15.10% 84.90% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307373114 G -> T LOC_Os03g13614.1 upstream_gene_variant ; 3472.0bp to feature; MODIFIER silent_mutation Average:63.478; most accessible tissue: Zhenshan97 root, score: 78.34 N N N N
vg0307373114 G -> T LOC_Os03g13630.1 upstream_gene_variant ; 1244.0bp to feature; MODIFIER silent_mutation Average:63.478; most accessible tissue: Zhenshan97 root, score: 78.34 N N N N
vg0307373114 G -> T LOC_Os03g13614.2 upstream_gene_variant ; 3472.0bp to feature; MODIFIER silent_mutation Average:63.478; most accessible tissue: Zhenshan97 root, score: 78.34 N N N N
vg0307373114 G -> T LOC_Os03g13614.3 upstream_gene_variant ; 3472.0bp to feature; MODIFIER silent_mutation Average:63.478; most accessible tissue: Zhenshan97 root, score: 78.34 N N N N
vg0307373114 G -> T LOC_Os03g13630-LOC_Os03g13640 intergenic_region ; MODIFIER silent_mutation Average:63.478; most accessible tissue: Zhenshan97 root, score: 78.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307373114 NA 3.03E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 3.19E-90 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 4.86E-92 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 4.34E-95 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.03E-14 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.59E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 3.19E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 3.25E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 4.22E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 8.12E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.51E-92 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.08E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.31E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 5.26E-36 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.73E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.35E-115 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 8.50E-07 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.78E-107 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 8.49E-103 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 9.61E-06 1.85E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 4.41E-121 mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.34E-21 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.07E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 8.44E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 3.77E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 4.28E-06 4.28E-06 mr1389_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 3.90E-65 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 7.64E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.00E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 7.98E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.07E-129 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.89E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.51E-106 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.09E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.32E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 4.54E-21 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 5.73E-59 mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 9.27E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 7.76E-66 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.54E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 8.90E-123 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 2.59E-06 2.93E-06 mr1962_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 1.53E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307373114 NA 2.14E-54 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251