\
| Variant ID: vg0307337230 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7337230 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATTTTAGAGTAACTTTTATTTTTTATTACACGAAATGCATCGTTTAGCAGTTTGAAAAGCATGCCACGAAAATCTTAATATTCATCCAACTCTTTTTTTT[T/G,A]
AATAATGGAATAGAGCATTCCAGTCTTTACTCAAAGAGCTATAGCCAAATCTTGTTTGAGAAAAGAACGGACCGATGATCAAATTTGGTGGGCTGAGTTG
CAACTCAGCCCACCAAATTTGATCATCGGTCCGTTCTTTTCTCAAACAAGATTTGGCTATAGCTCTTTGAGTAAAGACTGGAATGCTCTATTCCATTATT[A/C,T]
AAAAAAAAGAGTTGGATGAATATTAAGATTTTCGTGGCATGCTTTTCAAACTGCTAAACGATGCATTTCGTGTAATAAAAAATAAAAGTTACTCTAAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.90% | 0.17% | 0.00% | A: 0.02% |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.60% | 20.90% | 0.53% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.70% | 31.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.40% | 52.70% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 0.00% | 0.00% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307337230 | T -> A | LOC_Os03g13560.1 | upstream_gene_variant ; 2177.0bp to feature; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0307337230 | T -> A | LOC_Os03g13570.1 | downstream_gene_variant ; 2153.0bp to feature; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0307337230 | T -> A | LOC_Os03g13560-LOC_Os03g13570 | intergenic_region ; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0307337230 | T -> G | LOC_Os03g13560.1 | upstream_gene_variant ; 2177.0bp to feature; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0307337230 | T -> G | LOC_Os03g13570.1 | downstream_gene_variant ; 2153.0bp to feature; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0307337230 | T -> G | LOC_Os03g13560-LOC_Os03g13570 | intergenic_region ; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307337230 | 8.28E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 8.49E-08 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | NA | 5.21E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 1.26E-08 | NA | mr1745 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | NA | 6.85E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 9.90E-07 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 2.40E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 6.44E-08 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 4.58E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 2.57E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 2.84E-08 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 2.55E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307337230 | 2.05E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |