\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307337230:

Variant ID: vg0307337230 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7337230
Reference Allele: TAlternative Allele: G,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTAGAGTAACTTTTATTTTTTATTACACGAAATGCATCGTTTAGCAGTTTGAAAAGCATGCCACGAAAATCTTAATATTCATCCAACTCTTTTTTTT[T/G,A]
AATAATGGAATAGAGCATTCCAGTCTTTACTCAAAGAGCTATAGCCAAATCTTGTTTGAGAAAAGAACGGACCGATGATCAAATTTGGTGGGCTGAGTTG

Reverse complement sequence

CAACTCAGCCCACCAAATTTGATCATCGGTCCGTTCTTTTCTCAAACAAGATTTGGCTATAGCTCTTTGAGTAAAGACTGGAATGCTCTATTCCATTATT[A/C,T]
AAAAAAAAGAGTTGGATGAATATTAAGATTTTCGTGGCATGCTTTTCAAACTGCTAAACGATGCATTTCGTGTAATAAAAAATAAAAGTTACTCTAAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.90% 0.17% 0.00% A: 0.02%
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 78.60% 20.90% 0.53% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 95.80% 4.20% 0.00% 0.00% NA
Tropical Japonica  504 68.70% 31.20% 0.20% 0.00% NA
Japonica Intermediate  241 44.40% 52.70% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 0.00% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307337230 T -> A LOC_Os03g13560.1 upstream_gene_variant ; 2177.0bp to feature; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0307337230 T -> A LOC_Os03g13570.1 downstream_gene_variant ; 2153.0bp to feature; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0307337230 T -> A LOC_Os03g13560-LOC_Os03g13570 intergenic_region ; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0307337230 T -> G LOC_Os03g13560.1 upstream_gene_variant ; 2177.0bp to feature; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0307337230 T -> G LOC_Os03g13570.1 downstream_gene_variant ; 2153.0bp to feature; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0307337230 T -> G LOC_Os03g13560-LOC_Os03g13570 intergenic_region ; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307337230 8.28E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 8.49E-08 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 NA 5.21E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 1.26E-08 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 NA 6.85E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 9.90E-07 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 2.40E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 6.44E-08 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 4.58E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 2.57E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 2.84E-08 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 2.55E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307337230 2.05E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251