\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307109770:

Variant ID: vg0307109770 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7109770
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAACTAATATTGTATTGTGTTCTTTTAATATTTATTTCAGTCTTCTTAAAATGGAAAATTGGAACCATGCCATTATAATTTTGTAAAATTTGAGATAT[G/A]
CCATCATGACCCACATGTCATTGACTCATATGGGTCCTATATGTCATTGAGATACCGATGACATATCTCAAACTTTGCAAAATTATAATGGCATGATTCC

Reverse complement sequence

GGAATCATGCCATTATAATTTTGCAAAGTTTGAGATATGTCATCGGTATCTCAATGACATATAGGACCCATATGAGTCAATGACATGTGGGTCATGATGG[C/T]
ATATCTCAAATTTTACAAAATTATAATGGCATGGTTCCAATTTTCCATTTTAAGAAGACTGAAATAAATATTAAAAGAACACAATACAATATTAGTTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.20% 1.80% 0.00% 0.00% NA
All Indica  2759 97.30% 2.70% 0.00% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 4.20% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307109770 G -> A LOC_Os03g13180.1 downstream_gene_variant ; 1098.0bp to feature; MODIFIER silent_mutation Average:27.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0307109770 G -> A LOC_Os03g13190.1 downstream_gene_variant ; 1174.0bp to feature; MODIFIER silent_mutation Average:27.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0307109770 G -> A LOC_Os03g13190.2 downstream_gene_variant ; 3288.0bp to feature; MODIFIER silent_mutation Average:27.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0307109770 G -> A LOC_Os03g13180-LOC_Os03g13190 intergenic_region ; MODIFIER silent_mutation Average:27.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307109770 NA 5.87E-06 mr1057 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307109770 NA 4.34E-07 mr1504 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307109770 NA 4.32E-06 mr1797 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307109770 NA 4.32E-06 mr1801 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307109770 NA 1.54E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251