\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307009857:

Variant ID: vg0307009857 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7009857
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTCGTTTTCTCTGCGAGCTGCCGAGCTCTGATGGAGTAGGCTCACATAACCAGGCATGTCTAATGCGCGAAAGCTCGCTAGCGGCGAACCTAGCGAACA[G/A]
AAAACAAGATCTTTCTATATATAAAGTTTATATATTCAAAGTCCATATATATAAAGTTTACATATATAAAATCTCTCTATATAGAAAGTCTATGTATAGA

Reverse complement sequence

TCTATACATAGACTTTCTATATAGAGAGATTTTATATATGTAAACTTTATATATATGGACTTTGAATATATAAACTTTATATATAGAAAGATCTTGTTTT[C/T]
TGTTCGCTAGGTTCGCCGCTAGCGAGCTTTCGCGCATTAGACATGCCTGGTTATGTGAGCCTACTCCATCAGAGCTCGGCAGCTCGCAGAGAAAACGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 39.00% 2.07% 0.63% NA
All Indica  2759 93.10% 6.80% 0.11% 0.00% NA
All Japonica  1512 0.70% 91.40% 5.95% 1.98% NA
Aus  269 21.90% 78.10% 0.00% 0.00% NA
Indica I  595 91.40% 8.20% 0.34% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 94.00% 6.00% 0.00% 0.00% NA
Indica Intermediate  786 90.20% 9.80% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 85.30% 10.56% 3.26% NA
Tropical Japonica  504 0.20% 98.00% 1.39% 0.40% NA
Japonica Intermediate  241 0.80% 97.10% 0.83% 1.24% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 45.60% 48.90% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307009857 G -> A LOC_Os03g12970.1 downstream_gene_variant ; 2684.0bp to feature; MODIFIER silent_mutation Average:37.681; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg0307009857 G -> A LOC_Os03g12980.1 intron_variant ; MODIFIER silent_mutation Average:37.681; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg0307009857 G -> DEL N N silent_mutation Average:37.681; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307009857 NA 5.73E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 2.83E-12 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 3.54E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 8.98E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 1.72E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 1.66E-41 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 6.20E-47 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 8.70E-07 4.51E-10 mr1561 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 5.96E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 6.02E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 5.75E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 1.05E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 1.64E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 4.63E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 8.25E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 1.56E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 6.82E-21 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 2.10E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 2.94E-10 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 6.35E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 3.09E-11 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 1.60E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 5.25E-20 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 1.45E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 2.77E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 1.07E-09 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 5.42E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857 NA 9.24E-11 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251