Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307009857:

Variant ID: vg0307009857 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 7009857
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTCGTTTTCTCTGCGAGCTGCCGAGCTCTGATGGAGTAGGCTCACATAACCAGGCATGTCTAATGCGCGAAAGCTCGCTAGCGGCGAACCTAGCGAACA[G/A]
AAAACAAGATCTTTCTATATATAAAGTTTATATATTCAAAGTCCATATATATAAAGTTTACATATATAAAATCTCTCTATATAGAAAGTCTATGTATAGA

Reverse complement sequence

TCTATACATAGACTTTCTATATAGAGAGATTTTATATATGTAAACTTTATATATATGGACTTTGAATATATAAACTTTATATATAGAAAGATCTTGTTTT[C/T]
TGTTCGCTAGGTTCGCCGCTAGCGAGCTTTCGCGCATTAGACATGCCTGGTTATGTGAGCCTACTCCATCAGAGCTCGGCAGCTCGCAGAGAAAACGAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	39.00%	2.07%	0.63%	NA
All Indica	2759	93.10%	6.80%	0.11%	0.00%	NA
All Japonica	1512	0.70%	91.40%	5.95%	1.98%	NA
Aus	269	21.90%	78.10%	0.00%	0.00%	NA
Indica I	595	91.40%	8.20%	0.34%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	94.00%	6.00%	0.00%	0.00%	NA
Indica Intermediate	786	90.20%	9.80%	0.00%	0.00%	NA
Temperate Japonica	767	0.90%	85.30%	10.56%	3.26%	NA
Tropical Japonica	504	0.20%	98.00%	1.39%	0.40%	NA
Japonica Intermediate	241	0.80%	97.10%	0.83%	1.24%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	45.60%	48.90%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0307009857	G -> A	LOC_Os03g12970.1	downstream_gene_variant ; 2684.0bp to feature; MODIFIER	silent_mutation	Average:37.681; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N
vg0307009857	G -> A	LOC_Os03g12980.1	intron_variant ; MODIFIER	silent_mutation	Average:37.681; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N
vg0307009857	G -> DEL	N	N	silent_mutation	Average:37.681; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0307009857	NA	5.73E-49	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	2.83E-12	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	3.54E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	8.98E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	1.72E-06	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	1.66E-41	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	6.20E-47	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	8.70E-07	4.51E-10	mr1561	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	5.96E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	6.02E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	5.75E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	1.05E-17	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	1.64E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	4.63E-63	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	8.25E-12	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	1.56E-21	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	6.82E-21	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	2.10E-25	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	2.94E-10	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	6.35E-44	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	3.09E-11	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	1.60E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	5.25E-20	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	1.45E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	2.77E-07	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	1.07E-09	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	5.42E-31	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307009857	NA	9.24E-11	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251