\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307000761:

Variant ID: vg0307000761 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7000761
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGTGTGTTTAGTTCACGCCAAAATTGAAAATTTGGTTGAAATTGGAACGATGTGACAGAAAAGTTGGAAGTTTGTGTATAGAAAAGTTTAGATGTGAT[G/A]
AAAAAGTTGAAAGTTTGAAGAAAAACTTTGGATCTAAACTCGGCCTAAATCAAAAGCTGAACCGTTTGGGCAGCTTCTAATTAAAGCTGTAAATCCCTAA

Reverse complement sequence

TTAGGGATTTACAGCTTTAATTAGAAGCTGCCCAAACGGTTCAGCTTTTGATTTAGGCCGAGTTTAGATCCAAAGTTTTTCTTCAAACTTTCAACTTTTT[C/T]
ATCACATCTAAACTTTTCTATACACAAACTTCCAACTTTTCTGTCACATCGTTCCAATTTCAACCAAATTTTCAATTTTGGCGTGAACTAAACACACACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 3.30% 0.06% 0.00% NA
All Indica  2759 95.10% 4.80% 0.07% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.80% 8.90% 0.34% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 97.10% 2.70% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307000761 G -> A LOC_Os03g12950.1 upstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:59.186; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0307000761 G -> A LOC_Os03g12960.1 downstream_gene_variant ; 3217.0bp to feature; MODIFIER silent_mutation Average:59.186; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0307000761 G -> A LOC_Os03g12950-LOC_Os03g12960 intergenic_region ; MODIFIER silent_mutation Average:59.186; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307000761 NA 3.89E-08 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307000761 NA 2.26E-10 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307000761 NA 6.46E-12 mr1561_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307000761 NA 1.25E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307000761 NA 7.05E-11 mr1908_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307000761 NA 4.92E-12 mr1996_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251