\
| Variant ID: vg0307000761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7000761 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTGTGTGTTTAGTTCACGCCAAAATTGAAAATTTGGTTGAAATTGGAACGATGTGACAGAAAAGTTGGAAGTTTGTGTATAGAAAAGTTTAGATGTGAT[G/A]
AAAAAGTTGAAAGTTTGAAGAAAAACTTTGGATCTAAACTCGGCCTAAATCAAAAGCTGAACCGTTTGGGCAGCTTCTAATTAAAGCTGTAAATCCCTAA
TTAGGGATTTACAGCTTTAATTAGAAGCTGCCCAAACGGTTCAGCTTTTGATTTAGGCCGAGTTTAGATCCAAAGTTTTTCTTCAAACTTTCAACTTTTT[C/T]
ATCACATCTAAACTTTTCTATACACAAACTTCCAACTTTTCTGTCACATCGTTCCAATTTCAACCAAATTTTCAATTTTGGCGTGAACTAAACACACACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 3.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 95.10% | 4.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.80% | 8.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.10% | 2.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307000761 | G -> A | LOC_Os03g12950.1 | upstream_gene_variant ; 3578.0bp to feature; MODIFIER | silent_mutation | Average:59.186; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg0307000761 | G -> A | LOC_Os03g12960.1 | downstream_gene_variant ; 3217.0bp to feature; MODIFIER | silent_mutation | Average:59.186; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg0307000761 | G -> A | LOC_Os03g12950-LOC_Os03g12960 | intergenic_region ; MODIFIER | silent_mutation | Average:59.186; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307000761 | NA | 3.89E-08 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307000761 | NA | 2.26E-10 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307000761 | NA | 6.46E-12 | mr1561_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307000761 | NA | 1.25E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307000761 | NA | 7.05E-11 | mr1908_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307000761 | NA | 4.92E-12 | mr1996_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |