\
| Variant ID: vg0306976273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 6976273 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )
AGAATGCTAAGAAATGAAATTTGCTGAAAGTGTCAGTGCAAAAGAATACAAGATTCATTCTCATTTGGTCTGAATTCATCCATCGAAAACGCCATTATAA[G/A]
CATTAAGTAATCTCATGATTCTAAACTACTTGTATGTCTCCCAGAAACAAACTTGTACTTGTAATGCATGTGGAGTATTTGTTATTTCATCACAATTTTT
AAAAATTGTGATGAAATAACAAATACTCCACATGCATTACAAGTACAAGTTTGTTTCTGGGAGACATACAAGTAGTTTAGAATCATGAGATTACTTAATG[C/T]
TTATAATGGCGTTTTCGATGGATGAATTCAGACCAAATGAGAATGAATCTTGTATTCTTTTGCACTGACACTTTCAGCAAATTTCATTTCTTAGCATTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 3.70% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 87.10% | 11.50% | 1.39% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 0.10% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 64.70% | 33.90% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0306976273 | G -> A | LOC_Os03g12940.1 | downstream_gene_variant ; 4366.0bp to feature; MODIFIER | silent_mutation | Average:47.436; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0306976273 | G -> A | LOC_Os03g12940.2 | downstream_gene_variant ; 4369.0bp to feature; MODIFIER | silent_mutation | Average:47.436; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0306976273 | G -> A | LOC_Os03g12930.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.436; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| vg0306976273 | G -> A | LOC_Os03g12930.2 | intron_variant ; MODIFIER | silent_mutation | Average:47.436; most accessible tissue: Callus, score: 86.598 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0306976273 | NA | 1.74E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306976273 | NA | 2.00E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306976273 | NA | 6.24E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306976273 | NA | 5.06E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306976273 | NA | 7.53E-06 | mr1200_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306976273 | NA | 2.91E-07 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306976273 | NA | 9.78E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306976273 | NA | 5.52E-06 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306976273 | NA | 1.17E-06 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |