\
| Variant ID: vg0306929218 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 6929218 |
| Reference Allele: C | Alternative Allele: A,G |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )
CCATGGCTTGATTGTCTAGATATTGTCCTTCTTTTTATACTTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTGATTAGAATCTCAATCTCTAGC[C/A,G]
TGCTTCTTGGTTGCCGATTAGGGTAGTATCGGGGTTTCAGCCGATCTTACCTGATTTAACTATATTTGTTTTATATGCTTTATTGATATATTAAATCCGC
GCGGATTTAATATATCAATAAAGCATATAAAACAAATATAGTTAAATCAGGTAAGATCGGCTGAAACCCCGATACTACCCTAATCGGCAACCAAGAAGCA[G/T,C]
GCTAGAGATTGAGATTCTAATCACGACTCATAAGATCAAACTCAACTGATGCAGCTATAAGTATAAAAAGAAGGACAATATCTAGACAATCAAGCCATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.60% | 12.30% | 3.75% | 6.28% | G: 0.04% |
| All Indica | 2759 | 63.50% | 20.30% | 5.55% | 10.69% | NA |
| All Japonica | 1512 | 98.20% | 0.60% | 1.19% | 0.00% | NA |
| Aus | 269 | 98.10% | 0.70% | 0.74% | 0.00% | G: 0.37% |
| Indica I | 595 | 75.50% | 16.60% | 3.36% | 4.54% | NA |
| Indica II | 465 | 82.60% | 11.60% | 2.37% | 3.44% | NA |
| Indica III | 913 | 43.00% | 28.50% | 8.87% | 19.61% | NA |
| Indica Intermediate | 786 | 66.90% | 18.60% | 5.22% | 9.29% | NA |
| Temperate Japonica | 767 | 98.30% | 0.10% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 1.60% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 2.08% | 1.04% | G: 1.04% |
| Intermediate | 90 | 83.30% | 13.30% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0306929218 | C -> A | LOC_Os03g12860.1 | upstream_gene_variant ; 2491.0bp to feature; MODIFIER | silent_mutation | Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0306929218 | C -> A | LOC_Os03g12850-LOC_Os03g12860 | intergenic_region ; MODIFIER | silent_mutation | Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0306929218 | C -> DEL | N | N | silent_mutation | Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0306929218 | C -> G | LOC_Os03g12860.1 | upstream_gene_variant ; 2491.0bp to feature; MODIFIER | silent_mutation | Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0306929218 | C -> G | LOC_Os03g12850-LOC_Os03g12860 | intergenic_region ; MODIFIER | silent_mutation | Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0306929218 | NA | 7.63E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306929218 | NA | 4.79E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306929218 | NA | 2.42E-06 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306929218 | 2.13E-06 | 1.53E-08 | mr1821 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306929218 | NA | 4.17E-06 | mr1821 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |