Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306929218:

Variant ID: vg0306929218 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 6929218
Reference Allele: C	Alternative Allele: A,G
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CCATGGCTTGATTGTCTAGATATTGTCCTTCTTTTTATACTTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTGATTAGAATCTCAATCTCTAGC[C/A,G]
TGCTTCTTGGTTGCCGATTAGGGTAGTATCGGGGTTTCAGCCGATCTTACCTGATTTAACTATATTTGTTTTATATGCTTTATTGATATATTAAATCCGC

Reverse complement sequence

GCGGATTTAATATATCAATAAAGCATATAAAACAAATATAGTTAAATCAGGTAAGATCGGCTGAAACCCCGATACTACCCTAATCGGCAACCAAGAAGCA[G/T,C]
GCTAGAGATTGAGATTCTAATCACGACTCATAAGATCAAACTCAACTGATGCAGCTATAAGTATAAAAAGAAGGACAATATCTAGACAATCAAGCCATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.60%	12.30%	3.75%	6.28%	G: 0.04%
All Indica	2759	63.50%	20.30%	5.55%	10.69%	NA
All Japonica	1512	98.20%	0.60%	1.19%	0.00%	NA
Aus	269	98.10%	0.70%	0.74%	0.00%	G: 0.37%
Indica I	595	75.50%	16.60%	3.36%	4.54%	NA
Indica II	465	82.60%	11.60%	2.37%	3.44%	NA
Indica III	913	43.00%	28.50%	8.87%	19.61%	NA
Indica Intermediate	786	66.90%	18.60%	5.22%	9.29%	NA
Temperate Japonica	767	98.30%	0.10%	1.56%	0.00%	NA
Tropical Japonica	504	97.40%	1.60%	0.99%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	1.00%	2.08%	1.04%	G: 1.04%
Intermediate	90	83.30%	13.30%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0306929218	C -> A	LOC_Os03g12860.1	upstream_gene_variant ; 2491.0bp to feature; MODIFIER	silent_mutation	Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0306929218	C -> A	LOC_Os03g12850-LOC_Os03g12860	intergenic_region ; MODIFIER	silent_mutation	Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0306929218	C -> DEL	N	N	silent_mutation	Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0306929218	C -> G	LOC_Os03g12860.1	upstream_gene_variant ; 2491.0bp to feature; MODIFIER	silent_mutation	Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0306929218	C -> G	LOC_Os03g12850-LOC_Os03g12860	intergenic_region ; MODIFIER	silent_mutation	Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0306929218	NA	7.63E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306929218	NA	4.79E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306929218	NA	2.42E-06	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306929218	2.13E-06	1.53E-08	mr1821	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306929218	NA	4.17E-06	mr1821	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251