\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306929218:

Variant ID: vg0306929218 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6929218
Reference Allele: CAlternative Allele: A,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CCATGGCTTGATTGTCTAGATATTGTCCTTCTTTTTATACTTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTGATTAGAATCTCAATCTCTAGC[C/A,G]
TGCTTCTTGGTTGCCGATTAGGGTAGTATCGGGGTTTCAGCCGATCTTACCTGATTTAACTATATTTGTTTTATATGCTTTATTGATATATTAAATCCGC

Reverse complement sequence

GCGGATTTAATATATCAATAAAGCATATAAAACAAATATAGTTAAATCAGGTAAGATCGGCTGAAACCCCGATACTACCCTAATCGGCAACCAAGAAGCA[G/T,C]
GCTAGAGATTGAGATTCTAATCACGACTCATAAGATCAAACTCAACTGATGCAGCTATAAGTATAAAAAGAAGGACAATATCTAGACAATCAAGCCATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 12.30% 3.75% 6.28% G: 0.04%
All Indica  2759 63.50% 20.30% 5.55% 10.69% NA
All Japonica  1512 98.20% 0.60% 1.19% 0.00% NA
Aus  269 98.10% 0.70% 0.74% 0.00% G: 0.37%
Indica I  595 75.50% 16.60% 3.36% 4.54% NA
Indica II  465 82.60% 11.60% 2.37% 3.44% NA
Indica III  913 43.00% 28.50% 8.87% 19.61% NA
Indica Intermediate  786 66.90% 18.60% 5.22% 9.29% NA
Temperate Japonica  767 98.30% 0.10% 1.56% 0.00% NA
Tropical Japonica  504 97.40% 1.60% 0.99% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 1.00% 2.08% 1.04% G: 1.04%
Intermediate  90 83.30% 13.30% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306929218 C -> A LOC_Os03g12860.1 upstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0306929218 C -> A LOC_Os03g12850-LOC_Os03g12860 intergenic_region ; MODIFIER silent_mutation Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0306929218 C -> DEL N N silent_mutation Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0306929218 C -> G LOC_Os03g12860.1 upstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0306929218 C -> G LOC_Os03g12850-LOC_Os03g12860 intergenic_region ; MODIFIER silent_mutation Average:28.496; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306929218 NA 7.63E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306929218 NA 4.79E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306929218 NA 2.42E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306929218 2.13E-06 1.53E-08 mr1821 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306929218 NA 4.17E-06 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251