\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306899668:

Variant ID: vg0306899668 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6899668
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGTGCCACTTTCAACTAATACCTCTATTTTAGTTTATAAGATTTTCTAGCATTGCCCATGTTAGATTCATTAAATCTATATAAACGTGGGTAATGCTA[G/T]
AAAGTTTTATAACCTGAAACGGAGGAAGTAAAACTTTATCCACTTTTCGTTGAAGAAAATAACAGGCACAATGAACTCTGCCTGCAGCAAACCGATGACA

Reverse complement sequence

TGTCATCGGTTTGCTGCAGGCAGAGTTCATTGTGCCTGTTATTTTCTTCAACGAAAAGTGGATAAAGTTTTACTTCCTCCGTTTCAGGTTATAAAACTTT[C/A]
TAGCATTACCCACGTTTATATAGATTTAATGAATCTAACATGGGCAATGCTAGAAAATCTTATAAACTAAAATAGAGGTATTAGTTGAAAGTGGCACGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.30% 0.50% 0.15% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 97.90% 1.70% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 0.70% 0.52% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 7.50% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306899668 G -> T LOC_Os03g12830.1 upstream_gene_variant ; 173.0bp to feature; MODIFIER silent_mutation Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 N N N N
vg0306899668 G -> T LOC_Os03g12840.2 upstream_gene_variant ; 2256.0bp to feature; MODIFIER silent_mutation Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 N N N N
vg0306899668 G -> T LOC_Os03g12840.1 upstream_gene_variant ; 2256.0bp to feature; MODIFIER silent_mutation Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 N N N N
vg0306899668 G -> T LOC_Os03g12840.3 upstream_gene_variant ; 2256.0bp to feature; MODIFIER silent_mutation Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 N N N N
vg0306899668 G -> T LOC_Os03g12820.1 downstream_gene_variant ; 1240.0bp to feature; MODIFIER silent_mutation Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 N N N N
vg0306899668 G -> T LOC_Os03g12820.2 downstream_gene_variant ; 1313.0bp to feature; MODIFIER silent_mutation Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 N N N N
vg0306899668 G -> T LOC_Os03g12820-LOC_Os03g12830 intergenic_region ; MODIFIER silent_mutation Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306899668 2.62E-06 5.51E-06 mr1091 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306899668 4.43E-06 4.43E-06 mr1970 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306899668 NA 8.74E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251