| Variant ID: vg0306899668 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 6899668 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
AGCGTGCCACTTTCAACTAATACCTCTATTTTAGTTTATAAGATTTTCTAGCATTGCCCATGTTAGATTCATTAAATCTATATAAACGTGGGTAATGCTA[G/T]
AAAGTTTTATAACCTGAAACGGAGGAAGTAAAACTTTATCCACTTTTCGTTGAAGAAAATAACAGGCACAATGAACTCTGCCTGCAGCAAACCGATGACA
TGTCATCGGTTTGCTGCAGGCAGAGTTCATTGTGCCTGTTATTTTCTTCAACGAAAAGTGGATAAAGTTTTACTTCCTCCGTTTCAGGTTATAAAACTTT[C/A]
TAGCATTACCCACGTTTATATAGATTTAATGAATCTAACATGGGCAATGCTAGAAAATCTTATAAACTAAAATAGAGGTATTAGTTGAAAGTGGCACGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.30% | 0.50% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 1.70% | 0.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 0.70% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 7.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0306899668 | G -> T | LOC_Os03g12830.1 | upstream_gene_variant ; 173.0bp to feature; MODIFIER | silent_mutation | Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 | N | N | N | N |
| vg0306899668 | G -> T | LOC_Os03g12840.2 | upstream_gene_variant ; 2256.0bp to feature; MODIFIER | silent_mutation | Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 | N | N | N | N |
| vg0306899668 | G -> T | LOC_Os03g12840.1 | upstream_gene_variant ; 2256.0bp to feature; MODIFIER | silent_mutation | Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 | N | N | N | N |
| vg0306899668 | G -> T | LOC_Os03g12840.3 | upstream_gene_variant ; 2256.0bp to feature; MODIFIER | silent_mutation | Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 | N | N | N | N |
| vg0306899668 | G -> T | LOC_Os03g12820.1 | downstream_gene_variant ; 1240.0bp to feature; MODIFIER | silent_mutation | Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 | N | N | N | N |
| vg0306899668 | G -> T | LOC_Os03g12820.2 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 | N | N | N | N |
| vg0306899668 | G -> T | LOC_Os03g12820-LOC_Os03g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:72.33; most accessible tissue: Minghui63 flower, score: 86.285 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0306899668 | 2.62E-06 | 5.51E-06 | mr1091 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306899668 | 4.43E-06 | 4.43E-06 | mr1970 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306899668 | NA | 8.74E-06 | mr1594_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |