\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306758158:

Variant ID: vg0306758158 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6758158
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTTTTAGAGAGATTGGAAACAAGAACAATCGAGGTTAGGGCCCGTTCTACCATATAGAGGTTGGAAATAGAGGTCGGAAACAACTGATTAGGGTAGTC[C/T,A]
CAATCCATAGTATTTATAAACTGTGTATATAATGTCTCTACAATCCATGGTTTTTTAAATTTGGCCATTAATAAATACATCATCTCTCTTCTCTACCAAT

Reverse complement sequence

ATTGGTAGAGAAGAGAGATGATGTATTTATTAATGGCCAAATTTAAAAAACCATGGATTGTAGAGACATTATATACACAGTTTATAAATACTATGGATTG[G/A,T]
GACTACCCTAATCAGTTGTTTCCGACCTCTATTTCCAACCTCTATATGGTAGAACGGGCCCTAACCTCGATTGTTCTTGTTTCCAATCTCTCTAAAACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 13.40% 1.63% 1.65% A: 0.06%
All Indica  2759 72.20% 22.30% 2.68% 2.79% A: 0.04%
All Japonica  1512 99.70% 0.30% 0.00% 0.00% A: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 60.80% 31.80% 4.20% 3.19% NA
Indica II  465 35.70% 52.00% 6.45% 5.81% NA
Indica III  913 97.90% 1.50% 0.00% 0.55% NA
Indica Intermediate  786 72.40% 21.80% 2.42% 3.31% A: 0.13%
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.00% A: 0.20%
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 14.40% 3.33% 1.11% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306758158 C -> T LOC_Os03g12670.1 downstream_gene_variant ; 1166.0bp to feature; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> T LOC_Os03g12680.1 downstream_gene_variant ; 4824.0bp to feature; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> T LOC_Os03g12670.2 downstream_gene_variant ; 1166.0bp to feature; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> T LOC_Os03g12670.3 downstream_gene_variant ; 1166.0bp to feature; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> T LOC_Os03g12670-LOC_Os03g12680 intergenic_region ; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> A LOC_Os03g12670.1 downstream_gene_variant ; 1166.0bp to feature; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> A LOC_Os03g12680.1 downstream_gene_variant ; 4824.0bp to feature; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> A LOC_Os03g12670.2 downstream_gene_variant ; 1166.0bp to feature; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> A LOC_Os03g12670.3 downstream_gene_variant ; 1166.0bp to feature; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> A LOC_Os03g12670-LOC_Os03g12680 intergenic_region ; MODIFIER silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N
vg0306758158 C -> DEL N N silent_mutation Average:97.16; most accessible tissue: Minghui63 young leaf, score: 99.522 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0306758158 C A -0.07 -0.06 -0.04 -0.04 -0.05 -0.04
vg0306758158 C T -0.1 -0.07 -0.05 -0.06 -0.07 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306758158 NA 4.25E-19 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306758158 NA 1.00E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306758158 NA 5.65E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 9.27E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.16E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 1.23E-11 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.35E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 8.86E-06 mr1648 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 3.72E-06 mr1697 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 4.87E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 7.75E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.86E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 2.91E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 1.46E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.59E-06 mr1175_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 7.22E-12 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 4.13E-07 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 2.66E-29 mr1352_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.04E-16 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.13E-08 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 1.23E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.18E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 2.54E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 3.99E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 7.78E-08 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 8.37E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 2.94E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 1.14E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 2.97E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 4.25E-11 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 2.02E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 9.57E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.46E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.07E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 6.60E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 1.74E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.97E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 7.85E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 8.13E-07 mr1761_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 4.85E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 1.52E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 3.32E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 7.04E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 4.61E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306758158 NA 5.40E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251