Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306755101:

Variant ID: vg0306755101 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6755101
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGCAAGATTGGCCTTTGCCATGTTGGGTGCGCTCGCATGGCAGGCCACCGTAATAAAGATGATCTTTTTGTGTCCTGGGGGGAGTTCGCACGGGGGTTA[T/A]
TTTGTTTAGCCCCGGGTTCTCCCCCCAATCTTGTGTCCCGTTGTCCCCTGGTTGTCCTCAGATCCCACTGCGACTACATCGTTCAACGATCGCGCGTGAA

Reverse complement sequence

TTCACGCGCGATCGTTGAACGATGTAGTCGCAGTGGGATCTGAGGACAACCAGGGGACAACGGGACACAAGATTGGGGGGAGAACCCGGGGCTAAACAAA[A/T]
TAACCCCCGTGCGAACTCCCCCCAGGACACAAAAAGATCATCTTTATTACGGTGGCCTGCCATGCGAGCGCACCCAACATGGCAAAGGCCAATCTTGCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 9.80% 0.15% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 70.10% 29.40% 0.46% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 94.10% 5.90% 0.00% 0.00% NA
Tropical Japonica  504 43.50% 55.60% 0.99% 0.00% NA
Japonica Intermediate  241 49.40% 49.80% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306755101 T -> A LOC_Os03g12670.1 missense_variant ; p.Phe22Ile; MODERATE nonsynonymous_codon ; F22I Average:92.074; most accessible tissue: Minghui63 flag leaf, score: 98.827 unknown unknown DELETERIOUS 0.00
vg0306755101 T -> A LOC_Os03g12670.2 missense_variant ; p.Phe22Ile; MODERATE nonsynonymous_codon ; F22I Average:92.074; most accessible tissue: Minghui63 flag leaf, score: 98.827 unknown unknown DELETERIOUS 0.00
vg0306755101 T -> A LOC_Os03g12670.3 missense_variant ; p.Phe22Ile; MODERATE nonsynonymous_codon ; F22I Average:92.074; most accessible tissue: Minghui63 flag leaf, score: 98.827 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0306755101 T A -0.04 -0.04 -0.03 -0.04 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306755101 NA 7.01E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 2.28E-09 mr1180 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 2.36E-11 mr1183 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 4.19E-10 mr1503 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 2.63E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 6.74E-07 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 1.47E-06 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 2.01E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 9.76E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 1.79E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 3.11E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 3.10E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 5.15E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 1.23E-13 mr1794_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 1.35E-13 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 1.41E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 5.28E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306755101 NA 1.68E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251