Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306622337:

Variant ID: vg0306622337 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 6622337
Reference Allele: C	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGACCTCTAAGCGTGCCATTAGATAGATCTCGAGATTTGAGGAATTTTAGAAGTTGAACGGAGTCAAACGGACTTACGGTTGGGAAGATATTGAATTT[C/G,A]
TAAGATTATTGGATTTTTGGTCTAAAGGAAAAGGATTTATTTAAATCCTTTTTGAAAAAGAAAAGAAAAGAAAAGAAGGAGGGAGGGAAATTAGACTTCC

Reverse complement sequence

GGAAGTCTAATTTCCCTCCCTCCTTCTTTTCTTTTCTTTTCTTTTTCAAAAAGGATTTAAATAAATCCTTTTCCTTTAGACCAAAAATCCAATAATCTTA[G/C,T]
AAATTCAATATCTTCCCAACCGTAAGTCCGTTTGACTCCGTTCAACTTCTAAAATTCCTCAAATCTCGAGATCTATCTAATGGCACGCTTAGAGGTCAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.80%	32.20%	0.02%	0.00%	A: 0.02%
All Indica	2759	99.40%	0.60%	0.00%	0.00%	A: 0.04%
All Japonica	1512	3.80%	96.20%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.70%	0.20%	0.00%	0.00%	A: 0.11%
Indica Intermediate	786	99.00%	1.00%	0.00%	0.00%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	5.80%	94.00%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0306622337	C -> A	LOC_Os03g12520.1	upstream_gene_variant ; 4624.0bp to feature; MODIFIER	silent_mutation	Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203	N	N	N	N
vg0306622337	C -> A	LOC_Os03g12510.1	downstream_gene_variant ; 2621.0bp to feature; MODIFIER	silent_mutation	Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203	N	N	N	N
vg0306622337	C -> A	LOC_Os03g12500-LOC_Os03g12510	intergenic_region ; MODIFIER	silent_mutation	Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203	N	N	N	N
vg0306622337	C -> G	LOC_Os03g12520.1	upstream_gene_variant ; 4624.0bp to feature; MODIFIER	silent_mutation	Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203	N	N	N	N
vg0306622337	C -> G	LOC_Os03g12510.1	downstream_gene_variant ; 2621.0bp to feature; MODIFIER	silent_mutation	Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203	N	N	N	N
vg0306622337	C -> G	LOC_Os03g12500-LOC_Os03g12510	intergenic_region ; MODIFIER	silent_mutation	Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0306622337	NA	8.71E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337	1.19E-06	NA	mr1067_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337	8.43E-06	NA	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337	7.34E-07	NA	mr1110_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337	9.79E-06	NA	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337	1.88E-06	NA	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337	5.84E-06	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337	NA	3.87E-06	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251