\
| Variant ID: vg0306622337 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 6622337 |
| Reference Allele: C | Alternative Allele: G,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 313. )
ATTGACCTCTAAGCGTGCCATTAGATAGATCTCGAGATTTGAGGAATTTTAGAAGTTGAACGGAGTCAAACGGACTTACGGTTGGGAAGATATTGAATTT[C/G,A]
TAAGATTATTGGATTTTTGGTCTAAAGGAAAAGGATTTATTTAAATCCTTTTTGAAAAAGAAAAGAAAAGAAAAGAAGGAGGGAGGGAAATTAGACTTCC
GGAAGTCTAATTTCCCTCCCTCCTTCTTTTCTTTTCTTTTCTTTTTCAAAAAGGATTTAAATAAATCCTTTTCCTTTAGACCAAAAATCCAATAATCTTA[G/C,T]
AAATTCAATATCTTCCCAACCGTAAGTCCGTTTGACTCCGTTCAACTTCTAAAATTCCTCAAATCTCGAGATCTATCTAATGGCACGCTTAGAGGTCAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 32.20% | 0.02% | 0.00% | A: 0.02% |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | A: 0.04% |
| All Japonica | 1512 | 3.80% | 96.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.00% | 0.00% | A: 0.11% |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 94.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0306622337 | C -> A | LOC_Os03g12520.1 | upstream_gene_variant ; 4624.0bp to feature; MODIFIER | silent_mutation | Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| vg0306622337 | C -> A | LOC_Os03g12510.1 | downstream_gene_variant ; 2621.0bp to feature; MODIFIER | silent_mutation | Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| vg0306622337 | C -> A | LOC_Os03g12500-LOC_Os03g12510 | intergenic_region ; MODIFIER | silent_mutation | Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| vg0306622337 | C -> G | LOC_Os03g12520.1 | upstream_gene_variant ; 4624.0bp to feature; MODIFIER | silent_mutation | Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| vg0306622337 | C -> G | LOC_Os03g12510.1 | downstream_gene_variant ; 2621.0bp to feature; MODIFIER | silent_mutation | Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| vg0306622337 | C -> G | LOC_Os03g12500-LOC_Os03g12510 | intergenic_region ; MODIFIER | silent_mutation | Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0306622337 | NA | 8.71E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306622337 | 1.19E-06 | NA | mr1067_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306622337 | 8.43E-06 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306622337 | 7.34E-07 | NA | mr1110_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306622337 | 9.79E-06 | NA | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306622337 | 1.88E-06 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306622337 | 5.84E-06 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306622337 | NA | 3.87E-06 | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |