\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306622337:

Variant ID: vg0306622337 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6622337
Reference Allele: CAlternative Allele: G,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGACCTCTAAGCGTGCCATTAGATAGATCTCGAGATTTGAGGAATTTTAGAAGTTGAACGGAGTCAAACGGACTTACGGTTGGGAAGATATTGAATTT[C/G,A]
TAAGATTATTGGATTTTTGGTCTAAAGGAAAAGGATTTATTTAAATCCTTTTTGAAAAAGAAAAGAAAAGAAAAGAAGGAGGGAGGGAAATTAGACTTCC

Reverse complement sequence

GGAAGTCTAATTTCCCTCCCTCCTTCTTTTCTTTTCTTTTCTTTTTCAAAAAGGATTTAAATAAATCCTTTTCCTTTAGACCAAAAATCCAATAATCTTA[G/C,T]
AAATTCAATATCTTCCCAACCGTAAGTCCGTTTGACTCCGTTCAACTTCTAAAATTCCTCAAATCTCGAGATCTATCTAATGGCACGCTTAGAGGTCAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.20% 0.02% 0.00% A: 0.02%
All Indica  2759 99.40% 0.60% 0.00% 0.00% A: 0.04%
All Japonica  1512 3.80% 96.20% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.70% 0.20% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.00% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306622337 C -> A LOC_Os03g12520.1 upstream_gene_variant ; 4624.0bp to feature; MODIFIER silent_mutation Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N
vg0306622337 C -> A LOC_Os03g12510.1 downstream_gene_variant ; 2621.0bp to feature; MODIFIER silent_mutation Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N
vg0306622337 C -> A LOC_Os03g12500-LOC_Os03g12510 intergenic_region ; MODIFIER silent_mutation Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N
vg0306622337 C -> G LOC_Os03g12520.1 upstream_gene_variant ; 4624.0bp to feature; MODIFIER silent_mutation Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N
vg0306622337 C -> G LOC_Os03g12510.1 downstream_gene_variant ; 2621.0bp to feature; MODIFIER silent_mutation Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N
vg0306622337 C -> G LOC_Os03g12500-LOC_Os03g12510 intergenic_region ; MODIFIER silent_mutation Average:18.976; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306622337 NA 8.71E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337 1.19E-06 NA mr1067_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337 8.43E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337 7.34E-07 NA mr1110_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337 9.79E-06 NA mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337 1.88E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337 5.84E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306622337 NA 3.87E-06 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251