Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306413930:

Variant ID: vg0306413930 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 6413930
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGTGTTTCATTAACAATTTTTTTTATGTCGTATCAACCACCACCACTACTCCTTTATATGCCTGTTACTTAATTTATCTCGTCATGTGTTTTAGATGGT[C/A]
TTTTCTATCAATAGTCTTTATTTTTATCACAAATTTTAGTTATTTATAAATTGTATTCCTAATTGGAACCTTATTTTTCTTTTTTCTAATTTCAGATTTT

Reverse complement sequence

AAAATCTGAAATTAGAAAAAAGAAAAATAAGGTTCCAATTAGGAATACAATTTATAAATAACTAAAATTTGTGATAAAAATAAAGACTATTGATAGAAAA[G/T]
ACCATCTAAAACACATGACGAGATAAATTAAGTAACAGGCATATAAAGGAGTAGTGGTGGTGGTTGATACGACATAAAAAAAATTGTTAATGAAACACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	15.50%	0.38%	0.00%	NA
All Indica	2759	83.20%	16.40%	0.40%	0.00%	NA
All Japonica	1512	98.90%	0.70%	0.40%	0.00%	NA
Aus	269	8.90%	90.70%	0.37%	0.00%	NA
Indica I	595	53.60%	45.70%	0.67%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	94.30%	5.60%	0.11%	0.00%	NA
Indica Intermediate	786	83.10%	16.20%	0.76%	0.00%	NA
Temperate Japonica	767	98.30%	1.00%	0.65%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0306413930	C -> A	LOC_Os03g12230.1	upstream_gene_variant ; 3973.0bp to feature; MODIFIER	silent_mutation	Average:31.676; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0306413930	C -> A	LOC_Os03g12230.2	upstream_gene_variant ; 3973.0bp to feature; MODIFIER	silent_mutation	Average:31.676; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0306413930	C -> A	LOC_Os03g12220.1	downstream_gene_variant ; 2358.0bp to feature; MODIFIER	silent_mutation	Average:31.676; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0306413930	C -> A	LOC_Os03g12220-LOC_Os03g12230	intergenic_region ; MODIFIER	silent_mutation	Average:31.676; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0306413930	NA	1.34E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	4.30E-12	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	4.06E-06	mr1348_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	9.46E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	6.70E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	1.08E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	1.31E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	4.53E-06	mr1743_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	9.04E-09	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	8.59E-10	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	6.14E-06	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	9.08E-08	mr1842_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930	NA	7.63E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251