\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306413930:

Variant ID: vg0306413930 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6413930
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTGTTTCATTAACAATTTTTTTTATGTCGTATCAACCACCACCACTACTCCTTTATATGCCTGTTACTTAATTTATCTCGTCATGTGTTTTAGATGGT[C/A]
TTTTCTATCAATAGTCTTTATTTTTATCACAAATTTTAGTTATTTATAAATTGTATTCCTAATTGGAACCTTATTTTTCTTTTTTCTAATTTCAGATTTT

Reverse complement sequence

AAAATCTGAAATTAGAAAAAAGAAAAATAAGGTTCCAATTAGGAATACAATTTATAAATAACTAAAATTTGTGATAAAAATAAAGACTATTGATAGAAAA[G/T]
ACCATCTAAAACACATGACGAGATAAATTAAGTAACAGGCATATAAAGGAGTAGTGGTGGTGGTTGATACGACATAAAAAAAATTGTTAATGAAACACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 15.50% 0.38% 0.00% NA
All Indica  2759 83.20% 16.40% 0.40% 0.00% NA
All Japonica  1512 98.90% 0.70% 0.40% 0.00% NA
Aus  269 8.90% 90.70% 0.37% 0.00% NA
Indica I  595 53.60% 45.70% 0.67% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 94.30% 5.60% 0.11% 0.00% NA
Indica Intermediate  786 83.10% 16.20% 0.76% 0.00% NA
Temperate Japonica  767 98.30% 1.00% 0.65% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306413930 C -> A LOC_Os03g12230.1 upstream_gene_variant ; 3973.0bp to feature; MODIFIER silent_mutation Average:31.676; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0306413930 C -> A LOC_Os03g12230.2 upstream_gene_variant ; 3973.0bp to feature; MODIFIER silent_mutation Average:31.676; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0306413930 C -> A LOC_Os03g12220.1 downstream_gene_variant ; 2358.0bp to feature; MODIFIER silent_mutation Average:31.676; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0306413930 C -> A LOC_Os03g12220-LOC_Os03g12230 intergenic_region ; MODIFIER silent_mutation Average:31.676; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306413930 NA 1.34E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 4.30E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 4.06E-06 mr1348_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 9.46E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 6.70E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 1.08E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 1.31E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 4.53E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 9.04E-09 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 8.59E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 6.14E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 9.08E-08 mr1842_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306413930 NA 7.63E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251