Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306339520:

Variant ID: vg0306339520 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 6339520
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTAATTACTCAACAGTGTTACTGTTTTGCTCAATAAAACGTTTTACAACCGCCTTTTATGCAAATAGCCTCAAACCATCCTTGTATTCCCCTTGCACG[T/C]
CTGCATCGTTGGTGTGGCTTGCTGAGTACGGTGGTTGTACTCAGCCTTGCTATTATTCCCCCTTTTCAGAAGTGTAGTGCTTCTGAGCTGAAGACGGAGT

Reverse complement sequence

ACTCCGTCTTCAGCTCAGAAGCACTACACTTCTGAAAAGGGGGAATAATAGCAAGGCTGAGTACAACCACCGTACTCAGCAAGCCACACCAACGATGCAG[A/G]
CGTGCAAGGGGAATACAAGGATGGTTTGAGGCTATTTGCATAAAAGGCGGTTGTAAAACGTTTTATTGAGCAAAACAGTAACACTGTTGAGTAATTAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	49.20%	0.08%	0.00%	NA
All Indica	2759	71.90%	28.00%	0.07%	0.00%	NA
All Japonica	1512	1.70%	98.30%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	60.70%	39.30%	0.00%	0.00%	NA
Indica II	465	35.70%	64.10%	0.22%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	70.50%	29.40%	0.13%	0.00%	NA
Temperate Japonica	767	2.60%	97.40%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	38.90%	58.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0306339520	T -> C	LOC_Os03g12064.1	downstream_gene_variant ; 4387.0bp to feature; MODIFIER	silent_mutation	Average:65.794; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0306339520	T -> C	LOC_Os03g12064.2	downstream_gene_variant ; 4758.0bp to feature; MODIFIER	silent_mutation	Average:65.794; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0306339520	T -> C	LOC_Os03g12064.3	downstream_gene_variant ; 4758.0bp to feature; MODIFIER	silent_mutation	Average:65.794; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0306339520	T -> C	LOC_Os03g12064.6	downstream_gene_variant ; 4387.0bp to feature; MODIFIER	silent_mutation	Average:65.794; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0306339520	T -> C	LOC_Os03g12064.5	downstream_gene_variant ; 4387.0bp to feature; MODIFIER	silent_mutation	Average:65.794; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0306339520	T -> C	LOC_Os03g12064.4	downstream_gene_variant ; 4387.0bp to feature; MODIFIER	silent_mutation	Average:65.794; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0306339520	T -> C	LOC_Os03g12080.1	intron_variant ; MODIFIER	silent_mutation	Average:65.794; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0306339520	NA	2.77E-14	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306339520	NA	5.74E-06	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.05E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.62E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.17E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.66E-07	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	5.22E-08	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	9.83E-06	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	6.19E-06	mr1175_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	6.38E-06	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.02E-18	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	3.11E-10	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.63E-06	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	8.41E-09	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	4.10E-16	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.83E-11	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.20E-07	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	4.91E-14	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	4.80E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	4.22E-10	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	9.54E-07	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.06E-06	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	4.47E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	4.09E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.70E-07	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	4.34E-06	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	7.13E-06	mr1472_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	9.42E-06	mr1474_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	6.36E-11	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	3.40E-09	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.77E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	7.69E-12	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.36E-06	mr1520_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.24E-12	mr1546_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	6.12E-12	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	8.75E-07	mr1576_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.58E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.29E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.94E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	6.09E-09	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	2.61E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	3.79E-06	mr1761_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	1.21E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	3.02E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306339520	NA	5.49E-11	mr1971_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251