| Variant ID: vg0306293313 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 6293313 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGCCTTATTGGTATATCTCTAAAGGTGTGTTCGGAATCCCCAGTTCCCAACTCATCCATCTCGTTTTCCGTGCGCACGCTTTTCAAACTGTAAACAGTG[C/T]
GTTTTTTACAAAAAGTTTCTATACGAAAGTTGCTTTAAAAAATCATATTGATCCATTTTTTAAAAAAAGATTAGCTAATACTTAATTAATCATGCGCTAA
TTAGCGCATGATTAATTAAGTATTAGCTAATCTTTTTTTAAAAAATGGATCAATATGATTTTTTAAAGCAACTTTCGTATAGAAACTTTTTGTAAAAAAC[G/A]
CACTGTTTACAGTTTGAAAAGCGTGCGCACGGAAAACGAGATGGATGAGTTGGGAACTGGGGATTCCGAACACACCTTTAGAGATATACCAATAAGGCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 7.70% | 0.85% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 73.50% | 23.90% | 2.65% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 57.10% | 38.20% | 4.69% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.90% | 25.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0306293313 | C -> T | LOC_Os03g12010.3 | 5_prime_UTR_variant ; 1058.0bp to feature; MODIFIER | silent_mutation | Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0306293313 | C -> T | LOC_Os03g12010.4 | 5_prime_UTR_variant ; 1058.0bp to feature; MODIFIER | silent_mutation | Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0306293313 | C -> T | LOC_Os03g12010.2 | 5_prime_UTR_variant ; 1058.0bp to feature; MODIFIER | silent_mutation | Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0306293313 | C -> T | LOC_Os03g12000.1 | upstream_gene_variant ; 4862.0bp to feature; MODIFIER | silent_mutation | Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0306293313 | C -> T | LOC_Os03g12020.1 | upstream_gene_variant ; 2159.0bp to feature; MODIFIER | silent_mutation | Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0306293313 | C -> T | LOC_Os03g12010.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0306293313 | NA | 1.52E-12 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0306293313 | NA | 3.79E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0306293313 | 9.31E-06 | NA | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306293313 | NA | 1.04E-06 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306293313 | NA | 8.32E-07 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306293313 | NA | 8.31E-06 | mr1154 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306293313 | 6.02E-06 | 3.23E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306293313 | NA | 2.90E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306293313 | 5.83E-06 | 5.83E-06 | mr1802 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306293313 | 3.30E-06 | 3.30E-06 | mr1935 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |