\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306293313:

Variant ID: vg0306293313 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6293313
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGCCTTATTGGTATATCTCTAAAGGTGTGTTCGGAATCCCCAGTTCCCAACTCATCCATCTCGTTTTCCGTGCGCACGCTTTTCAAACTGTAAACAGTG[C/T]
GTTTTTTACAAAAAGTTTCTATACGAAAGTTGCTTTAAAAAATCATATTGATCCATTTTTTAAAAAAAGATTAGCTAATACTTAATTAATCATGCGCTAA

Reverse complement sequence

TTAGCGCATGATTAATTAAGTATTAGCTAATCTTTTTTTAAAAAATGGATCAATATGATTTTTTAAAGCAACTTTCGTATAGAAACTTTTTGTAAAAAAC[G/A]
CACTGTTTACAGTTTGAAAAGCGTGCGCACGGAAAACGAGATGGATGAGTTGGGAACTGGGGATTCCGAACACACCTTTAGAGATATACCAATAAGGCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 7.70% 0.85% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 73.50% 23.90% 2.65% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 57.10% 38.20% 4.69% 0.00% NA
Tropical Japonica  504 98.20% 1.40% 0.40% 0.00% NA
Japonica Intermediate  241 73.90% 25.30% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306293313 C -> T LOC_Os03g12010.3 5_prime_UTR_variant ; 1058.0bp to feature; MODIFIER silent_mutation Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0306293313 C -> T LOC_Os03g12010.4 5_prime_UTR_variant ; 1058.0bp to feature; MODIFIER silent_mutation Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0306293313 C -> T LOC_Os03g12010.2 5_prime_UTR_variant ; 1058.0bp to feature; MODIFIER silent_mutation Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0306293313 C -> T LOC_Os03g12000.1 upstream_gene_variant ; 4862.0bp to feature; MODIFIER silent_mutation Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0306293313 C -> T LOC_Os03g12020.1 upstream_gene_variant ; 2159.0bp to feature; MODIFIER silent_mutation Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0306293313 C -> T LOC_Os03g12010.1 intron_variant ; MODIFIER silent_mutation Average:57.221; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306293313 NA 1.52E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306293313 NA 3.79E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306293313 9.31E-06 NA mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306293313 NA 1.04E-06 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306293313 NA 8.32E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306293313 NA 8.31E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306293313 6.02E-06 3.23E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306293313 NA 2.90E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306293313 5.83E-06 5.83E-06 mr1802 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306293313 3.30E-06 3.30E-06 mr1935 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251