\
| Variant ID: vg0306155502 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 6155502 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCCGTGTCCAACTTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTCGTATTTTTCATTGTTTGTTAGATGATAAAACATTATTAATATTTTATGC[G/A]
TAACTTGTCTTTTTATTTTTTTTCATAATTTTTTCAAATAAGACGGACGGTCAAACGTTGGGCACGGAAACCAGTGTTTGTCTTTTTTTTGGACGGAGGG
CCCTCCGTCCAAAAAAAAGACAAACACTGGTTTCCGTGCCCAACGTTTGACCGTCCGTCTTATTTGAAAAAATTATGAAAAAAAATAAAAAGACAAGTTA[C/T]
GCATAAAATATTAATAATGTTTTATCATCTAACAAACAATGAAAAATACGAATTATAAAAAAATTTCATATAAGACGGACAGTCAAAGTTGGACACGGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 8.90% | 0.17% | 0.08% | NA |
| All Indica | 2759 | 93.60% | 6.00% | 0.29% | 0.14% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 15.20% | 84.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.20% | 0.50% | 0.17% | NA |
| Indica II | 465 | 87.70% | 12.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 95.40% | 4.50% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 90.70% | 8.50% | 0.51% | 0.25% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0306155502 | G -> A | LOC_Os03g11770.1 | upstream_gene_variant ; 4446.0bp to feature; MODIFIER | silent_mutation | Average:60.664; most accessible tissue: Callus, score: 93.699 | N | N | N | N |
| vg0306155502 | G -> A | LOC_Os03g11760.1 | downstream_gene_variant ; 319.0bp to feature; MODIFIER | silent_mutation | Average:60.664; most accessible tissue: Callus, score: 93.699 | N | N | N | N |
| vg0306155502 | G -> A | LOC_Os03g11760-LOC_Os03g11770 | intergenic_region ; MODIFIER | silent_mutation | Average:60.664; most accessible tissue: Callus, score: 93.699 | N | N | N | N |
| vg0306155502 | G -> DEL | N | N | silent_mutation | Average:60.664; most accessible tissue: Callus, score: 93.699 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0306155502 | NA | 1.85E-09 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 1.70E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 3.24E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 6.05E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 1.63E-08 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 1.21E-09 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 1.91E-12 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 6.44E-08 | mr1684 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 4.49E-11 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 6.43E-09 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 4.68E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 5.53E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 1.51E-07 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 1.83E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 3.74E-11 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 5.54E-09 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 3.24E-06 | mr1291_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 4.97E-06 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 6.32E-09 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 2.15E-07 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 1.71E-09 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 1.23E-08 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 7.22E-10 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0306155502 | NA | 4.29E-06 | mr1892_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |