\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306155502:

Variant ID: vg0306155502 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6155502
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCGTGTCCAACTTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTCGTATTTTTCATTGTTTGTTAGATGATAAAACATTATTAATATTTTATGC[G/A]
TAACTTGTCTTTTTATTTTTTTTCATAATTTTTTCAAATAAGACGGACGGTCAAACGTTGGGCACGGAAACCAGTGTTTGTCTTTTTTTTGGACGGAGGG

Reverse complement sequence

CCCTCCGTCCAAAAAAAAGACAAACACTGGTTTCCGTGCCCAACGTTTGACCGTCCGTCTTATTTGAAAAAATTATGAAAAAAAATAAAAAGACAAGTTA[C/T]
GCATAAAATATTAATAATGTTTTATCATCTAACAAACAATGAAAAATACGAATTATAAAAAAATTTCATATAAGACGGACAGTCAAAGTTGGACACGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 8.90% 0.17% 0.08% NA
All Indica  2759 93.60% 6.00% 0.29% 0.14% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 99.20% 0.20% 0.50% 0.17% NA
Indica II  465 87.70% 12.00% 0.22% 0.00% NA
Indica III  913 95.40% 4.50% 0.00% 0.11% NA
Indica Intermediate  786 90.70% 8.50% 0.51% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306155502 G -> A LOC_Os03g11770.1 upstream_gene_variant ; 4446.0bp to feature; MODIFIER silent_mutation Average:60.664; most accessible tissue: Callus, score: 93.699 N N N N
vg0306155502 G -> A LOC_Os03g11760.1 downstream_gene_variant ; 319.0bp to feature; MODIFIER silent_mutation Average:60.664; most accessible tissue: Callus, score: 93.699 N N N N
vg0306155502 G -> A LOC_Os03g11760-LOC_Os03g11770 intergenic_region ; MODIFIER silent_mutation Average:60.664; most accessible tissue: Callus, score: 93.699 N N N N
vg0306155502 G -> DEL N N silent_mutation Average:60.664; most accessible tissue: Callus, score: 93.699 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306155502 NA 1.85E-09 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 1.70E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 3.24E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 6.05E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 1.63E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 1.21E-09 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 1.91E-12 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 6.44E-08 mr1684 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 4.49E-11 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 6.43E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 4.68E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 5.53E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 1.51E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 1.83E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 3.74E-11 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 5.54E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 3.24E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 4.97E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 6.32E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 2.15E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 1.71E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 1.23E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 7.22E-10 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306155502 NA 4.29E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251