RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0306131419:

Variant ID: vg0306131419 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 6131419
Reference Allele: TAA	Alternative Allele: TA,TAAA,T,AAA
Primary Allele: TAA	Secondary Allele: AAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACTTCTGTGTCAGTTCCATTGCCCCGAATGTTCGCACAAGGATTTTAAATTTCACGAACGGAGTTTTATTTCGATATATGTGTATACAATTTTTTTTT[TAA/TA,TAAA,T,AAA]
AAAAAGCGTGGGCTATATGTGCCCTACCTCTAAACAAGTTCGGAAAGGGTCAAGTTTGTGTTATTTACAAACTGCAACAGCTTGGATGGCTAGATGGTTT

Reverse complement sequence

AAACCATCTAGCCATCCAAGCTGTTGCAGTTTGTAAATAACACAAACTTGACCCTTTCCGAACTTGTTTAGAGGTAGGGCACATATAGCCCACGCTTTTT[TTA/TA,TTTA,A,TTT]
AAAAAAAAATTGTATACACATATATCGAAATAAAACTCCGTTCGTGAAATTTAAAATCCTTGTGCGAACATTCGGGGCAATGGAACTGACACAGAAGTAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of TAA(primary allele)	Frequency of AAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.60%	10.20%	2.33%	0.00%	TA: 7.62%; TAAA: 0.17%; T: 0.04%
All Indica	2759	95.30%	0.20%	0.69%	0.00%	TA: 3.52%; TAAA: 0.25%; T: 0.07%
All Japonica	1512	63.80%	30.40%	5.62%	0.00%	TA: 0.13%
Aus	269	14.90%	0.40%	0.00%	0.00%	TA: 84.76%
Indica I	595	98.50%	0.00%	0.84%	0.00%	TA: 0.67%
Indica II	465	98.90%	0.20%	0.22%	0.00%	T: 0.43%; TA: 0.22%
Indica III	913	93.60%	0.10%	0.33%	0.00%	TA: 5.91%
Indica Intermediate	786	92.60%	0.40%	1.27%	0.00%	TA: 4.83%; TAAA: 0.89%
Temperate Japonica	767	79.90%	13.70%	6.39%	0.00%	NA
Tropical Japonica	504	46.40%	51.00%	2.18%	0.00%	TA: 0.40%
Japonica Intermediate	241	49.00%	40.70%	10.37%	0.00%	NA
VI/Aromatic	96	66.70%	3.10%	4.17%	0.00%	TA: 26.04%
Intermediate	90	73.30%	14.40%	2.22%	0.00%	TA: 8.89%; TAAA: 1.11%

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0306131419	TAA -> T	LOC_Os03g11720.1	downstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> T	LOC_Os03g11734.1	downstream_gene_variant ; 425.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> T	LOC_Os03g11734.2	downstream_gene_variant ; 426.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> T	LOC_Os03g11734.3	downstream_gene_variant ; 426.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> T	LOC_Os03g11720-LOC_Os03g11734	intergenic_region ; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TA	LOC_Os03g11720.1	downstream_gene_variant ; 266.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TA	LOC_Os03g11734.1	downstream_gene_variant ; 424.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TA	LOC_Os03g11734.2	downstream_gene_variant ; 425.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TA	LOC_Os03g11734.3	downstream_gene_variant ; 425.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TA	LOC_Os03g11720-LOC_Os03g11734	intergenic_region ; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> AAA	LOC_Os03g11720.1	downstream_gene_variant ; 264.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> AAA	LOC_Os03g11734.1	downstream_gene_variant ; 426.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> AAA	LOC_Os03g11734.2	downstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> AAA	LOC_Os03g11734.3	downstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> AAA	LOC_Os03g11720-LOC_Os03g11734	intergenic_region ; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TAAA	LOC_Os03g11720.1	downstream_gene_variant ; 267.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TAAA	LOC_Os03g11734.1	downstream_gene_variant ; 423.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TAAA	LOC_Os03g11734.2	downstream_gene_variant ; 424.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TAAA	LOC_Os03g11734.3	downstream_gene_variant ; 424.0bp to feature; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N
vg0306131419	TAA -> TAAA	LOC_Os03g11720-LOC_Os03g11734	intergenic_region ; MODIFIER	silent_mutation	Average:71.544; most accessible tissue: Callus, score: 86.201	N	N	N	N

Showing 1 to 20 of 20 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0306131419	NA	9.85E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	NA	8.01E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	2.54E-07	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	NA	2.90E-06	mr1441_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	NA	8.71E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	NA	1.39E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	NA	1.59E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	3.26E-06	NA	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	NA	9.00E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306131419	NA	4.67E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 10 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0306131419:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact