\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306113744:

Variant ID: vg0306113744 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6113744
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCATATATACGACACGATCGATCCTACTAAAATCCGATCATAGGGTGTGTTTAGTTCTAAAGTTTTTTTTCTAAACTTTTAACTTTCCATCACATCAAA[C/T]
CTTTCATACACACACAACTTTTCAGTCACATCGTCTCCAATTTCAACCAAATTTTAAACTTTGGCCAATCTAAACACACCCATAGTTGAGCCAGCCCTTG

Reverse complement sequence

CAAGGGCTGGCTCAACTATGGGTGTGTTTAGATTGGCCAAAGTTTAAAATTTGGTTGAAATTGGAGACGATGTGACTGAAAAGTTGTGTGTGTATGAAAG[G/A]
TTTGATGTGATGGAAAGTTAAAAGTTTAGAAAAAAAACTTTAGAACTAAACACACCCTATGATCGGATTTTAGTAGGATCGATCGTGTCGTATATATGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 3.40% 3.89% 2.73% NA
All Indica  2759 85.10% 3.80% 6.45% 4.60% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.07% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 94.60% 0.00% 4.03% 1.34% NA
Indica II  465 66.20% 12.50% 15.27% 6.02% NA
Indica III  913 91.10% 0.90% 2.30% 5.70% NA
Indica Intermediate  786 82.20% 5.00% 7.89% 4.96% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 55.20% 43.80% 1.04% 0.00% NA
Intermediate  90 86.70% 8.90% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306113744 C -> T LOC_Os03g11690.1 upstream_gene_variant ; 1594.0bp to feature; MODIFIER silent_mutation Average:78.159; most accessible tissue: Zhenshan97 root, score: 92.915 N N N N
vg0306113744 C -> T LOC_Os03g11690.2 upstream_gene_variant ; 1594.0bp to feature; MODIFIER silent_mutation Average:78.159; most accessible tissue: Zhenshan97 root, score: 92.915 N N N N
vg0306113744 C -> T LOC_Os03g11680-LOC_Os03g11690 intergenic_region ; MODIFIER silent_mutation Average:78.159; most accessible tissue: Zhenshan97 root, score: 92.915 N N N N
vg0306113744 C -> DEL N N silent_mutation Average:78.159; most accessible tissue: Zhenshan97 root, score: 92.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0306113744 C T -0.02 -0.02 -0.02 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306113744 NA 1.84E-09 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 3.63E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 4.19E-08 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 5.79E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 5.97E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 1.28E-06 mr1742 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 7.39E-06 mr1742 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 4.57E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 9.66E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 1.30E-08 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306113744 NA 8.13E-06 mr1398_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251