\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305905054:

Variant ID: vg0305905054 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 5905054
Reference Allele: TAlternative Allele: A,TGA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGCACACCTGCACTGCAGAGAATGTTCCAAGTGTACTCCTGCTGATGCTGATGCTGCAGTTGCAGTCATGTGTCCCAAGTCCCAAAGTCATGTGTGTG[T/A,TGA]
GTGTGAGAGAGAGAAAAGATTTGATGACGAGATGGAAAGCGTTTTGTACTTTAGTACTTCTAGGAGAAGTACAGCAATGCATGCAGTGCAGTGCAGTGCA

Reverse complement sequence

TGCACTGCACTGCACTGCATGCATTGCTGTACTTCTCCTAGAAGTACTAAAGTACAAAACGCTTTCCATCTCGTCATCAAATCTTTTCTCTCTCTCACAC[A/T,TCA]
CACACACATGACTTTGGGACTTGGGACACATGACTGCAACTGCAGCATCAGCATCAGCAGGAGTACACTTGGAACATTCTCTGCAGTGCAGGTGTGCAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 5.60% 0.97% 0.51% TGA: 0.02%
All Indica  2759 95.80% 1.80% 1.56% 0.80% TGA: 0.04%
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 28.60% 71.40% 0.00% 0.00% NA
Indica I  595 97.30% 0.20% 2.35% 0.17% NA
Indica II  465 97.00% 0.00% 1.72% 1.29% NA
Indica III  913 94.70% 3.60% 0.55% 0.99% TGA: 0.11%
Indica Intermediate  786 95.00% 2.20% 2.04% 0.76% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305905054 T -> A LOC_Os03g11460.1 upstream_gene_variant ; 2649.0bp to feature; MODIFIER silent_mutation Average:87.018; most accessible tissue: Callus, score: 99.885 N N N N
vg0305905054 T -> A LOC_Os03g11450.1 downstream_gene_variant ; 2593.0bp to feature; MODIFIER silent_mutation Average:87.018; most accessible tissue: Callus, score: 99.885 N N N N
vg0305905054 T -> A LOC_Os03g11450-LOC_Os03g11460 intergenic_region ; MODIFIER silent_mutation Average:87.018; most accessible tissue: Callus, score: 99.885 N N N N
vg0305905054 T -> DEL N N silent_mutation Average:87.018; most accessible tissue: Callus, score: 99.885 N N N N
vg0305905054 T -> TGA LOC_Os03g11460.1 upstream_gene_variant ; 2648.0bp to feature; MODIFIER silent_mutation Average:87.018; most accessible tissue: Callus, score: 99.885 N N N N
vg0305905054 T -> TGA LOC_Os03g11450.1 downstream_gene_variant ; 2594.0bp to feature; MODIFIER silent_mutation Average:87.018; most accessible tissue: Callus, score: 99.885 N N N N
vg0305905054 T -> TGA LOC_Os03g11450-LOC_Os03g11460 intergenic_region ; MODIFIER silent_mutation Average:87.018; most accessible tissue: Callus, score: 99.885 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0305905054 T A -0.02 0.0 0.0 0.0 -0.01 -0.01
vg0305905054 T TGA -0.29 -0.01 0.0 0.09 -0.07 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305905054 2.78E-08 1.25E-17 mr1114 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 5.17E-08 9.57E-17 mr1116 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 9.53E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 3.79E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 5.09E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 NA 3.58E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 7.82E-06 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 6.52E-06 6.10E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 8.21E-06 6.04E-19 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 NA 1.78E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 3.44E-06 8.04E-20 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 9.68E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 2.39E-06 1.32E-19 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 NA 1.21E-21 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 9.40E-06 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 9.25E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905054 5.26E-06 1.32E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251