\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305373006:

Variant ID: vg0305373006 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5373006
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.22, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CCGACTGGCTTAGGGTTTGGTACTTGTGTCCTGCCTCCACATCAGCTTCAGAGACCGCGCCGGCGCCGGGATGTATTCCTCACCTCCCAAGGGTTTAAAG[C/T]
GGCGCAGTCGATTTCTCGCTCGTTCGATCCGAGCGGGGTATCGTCGTGGTTATGGGGAAGCTGCTGGACCTGAAGCGGCTCATGTCCGTGCCGAAGGAGC

Reverse complement sequence

GCTCCTTCGGCACGGACATGAGCCGCTTCAGGTCCAGCAGCTTCCCCATAACCACGACGATACCCCGCTCGGATCGAACGAGCGAGAAATCGACTGCGCC[G/A]
CTTTAAACCCTTGGGAGGTGAGGAATACATCCCGGCGCCGGCGCGGTCTCTGAAGCTGATGTGGAGGCAGGACACAAGTACCAAACCCTAAGCCAGTCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 23.10% 0.32% 10.03% NA
All Indica  2759 98.20% 0.80% 0.07% 0.94% NA
All Japonica  1512 2.10% 68.80% 0.79% 28.24% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 93.10% 3.00% 0.43% 3.44% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 0.50% 0.00% 1.27% NA
Temperate Japonica  767 0.90% 97.90% 0.00% 1.17% NA
Tropical Japonica  504 3.40% 18.70% 2.18% 75.79% NA
Japonica Intermediate  241 3.30% 81.30% 0.41% 14.94% NA
VI/Aromatic  96 90.60% 5.20% 0.00% 4.17% NA
Intermediate  90 56.70% 24.40% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305373006 C -> T LOC_Os03g10540.1 5_prime_UTR_variant ; 52.0bp to feature; MODIFIER silent_mutation Average:94.473; most accessible tissue: Callus, score: 99.642 N N N N
vg0305373006 C -> T LOC_Os03g10530.1 upstream_gene_variant ; 4905.0bp to feature; MODIFIER silent_mutation Average:94.473; most accessible tissue: Callus, score: 99.642 N N N N
vg0305373006 C -> T LOC_Os03g10540.2 upstream_gene_variant ; 2343.0bp to feature; MODIFIER silent_mutation Average:94.473; most accessible tissue: Callus, score: 99.642 N N N N
vg0305373006 C -> DEL N N silent_mutation Average:94.473; most accessible tissue: Callus, score: 99.642 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0305373006 C T -0.11 -0.12 -0.12 -0.09 -0.09 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305373006 NA 1.81E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.64E-41 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 4.35E-42 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 4.73E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 2.33E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.34E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 4.34E-16 mr1156 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.99E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.37E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 4.33E-32 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 3.41E-42 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 2.29E-54 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.08E-26 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 5.79E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 9.71E-52 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 2.51E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 6.35E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 3.37E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.75E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 6.81E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 2.33E-52 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.06E-77 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 4.47E-53 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 3.78E-58 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.65E-36 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 1.06E-36 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 7.46E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 4.58E-33 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305373006 NA 3.13E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251