\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305333401:

Variant ID: vg0305333401 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5333401
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GCATATATGCAACTCTACAAAATCTTAAGTCCAAACTCAACTCACACGTCGAGATATAAAAAAGACAAATTCAGCGTATGAATAGTAGCGTACTGTTTAT[A/G]
TCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTAGTAGGTATCATTATACTCTATATTGTTAATTTTTT

Reverse complement sequence

AAAAAATTAACAATATAGAGTATAATGATACCTACTAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGA[T/C]
ATAAACAGTACGCTACTATTCATACGCTGAATTTGTCTTTTTTATATCTCGACGTGTGAGTTGAGTTTGGACTTAAGATTTTGTAGAGTTGCATATATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.20% 17.70% 0.13% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 48.90% 50.70% 0.40% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 80.80% 18.50% 0.65% 0.00% NA
Tropical Japonica  504 9.30% 90.70% 0.00% 0.00% NA
Japonica Intermediate  241 29.90% 69.70% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305333401 A -> G LOC_Os03g10469.1 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0305333401 A -> G LOC_Os03g10469.2 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0305333401 A -> G LOC_Os03g10478.1 intron_variant ; MODIFIER silent_mutation Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305333401 NA 6.09E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401 6.19E-08 5.25E-10 mr1602 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401 NA 5.94E-07 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401 NA 4.95E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401 NA 1.99E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401 NA 6.82E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401 NA 1.05E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401 NA 3.16E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305333401 NA 6.36E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251