\
| Variant ID: vg0305333401 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 5333401 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )
GCATATATGCAACTCTACAAAATCTTAAGTCCAAACTCAACTCACACGTCGAGATATAAAAAAGACAAATTCAGCGTATGAATAGTAGCGTACTGTTTAT[A/G]
TCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTAGTAGGTATCATTATACTCTATATTGTTAATTTTTT
AAAAAATTAACAATATAGAGTATAATGATACCTACTAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGA[T/C]
ATAAACAGTACGCTACTATTCATACGCTGAATTTGTCTTTTTTATATCTCGACGTGTGAGTTGAGTTTGGACTTAAGATTTTGTAGAGTTGCATATATGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.20% | 17.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 48.90% | 50.70% | 0.40% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 80.80% | 18.50% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.90% | 69.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0305333401 | A -> G | LOC_Os03g10469.1 | upstream_gene_variant ; 2806.0bp to feature; MODIFIER | silent_mutation | Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053 | N | N | N | N |
| vg0305333401 | A -> G | LOC_Os03g10469.2 | upstream_gene_variant ; 2806.0bp to feature; MODIFIER | silent_mutation | Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053 | N | N | N | N |
| vg0305333401 | A -> G | LOC_Os03g10478.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.271; most accessible tissue: Zhenshan97 flower, score: 85.053 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0305333401 | NA | 6.09E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305333401 | 6.19E-08 | 5.25E-10 | mr1602 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305333401 | NA | 5.94E-07 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305333401 | NA | 4.95E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305333401 | NA | 1.99E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305333401 | NA | 6.82E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305333401 | NA | 1.05E-09 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305333401 | NA | 3.16E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305333401 | NA | 6.36E-06 | mr1923_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |