\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305293070:

Variant ID: vg0305293070 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5293070
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTATAAACTAGACACACCCATCACATTTTATCAAACTCGTCCGATAAATTCGTGGCTAGCTACTCTCCCTGTCCCAAAATAAGACAAATCCTGGGTTT[C/A]
CGTGTCCAACATTTGACTGTATGTTTTATATGAAATATTTTTATAATTAGTATTTCCATTGTTGTTAGATGATAAAACATGATTAATACTTTATGCGTGA

Reverse complement sequence

TCACGCATAAAGTATTAATCATGTTTTATCATCTAACAACAATGGAAATACTAATTATAAAAATATTTCATATAAAACATACAGTCAAATGTTGGACACG[G/T]
AAACCCAGGATTTGTCTTATTTTGGGACAGGGAGAGTAGCTAGCCACGAATTTATCGGACGAGTTTGATAAAATGTGATGGGTGTGTCTAGTTTATAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 22.40% 1.74% 0.00% NA
All Indica  2759 59.40% 37.70% 2.90% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 26.60% 65.70% 7.73% 0.00% NA
Indica II  465 37.00% 60.00% 3.01% 0.00% NA
Indica III  913 89.20% 10.50% 0.33% 0.00% NA
Indica Intermediate  786 63.00% 34.90% 2.16% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305293070 C -> A LOC_Os03g10370.1 upstream_gene_variant ; 2505.0bp to feature; MODIFIER silent_mutation Average:47.547; most accessible tissue: Callus, score: 74.964 N N N N
vg0305293070 C -> A LOC_Os03g10390.1 upstream_gene_variant ; 1453.0bp to feature; MODIFIER silent_mutation Average:47.547; most accessible tissue: Callus, score: 74.964 N N N N
vg0305293070 C -> A LOC_Os03g10380.1 downstream_gene_variant ; 998.0bp to feature; MODIFIER silent_mutation Average:47.547; most accessible tissue: Callus, score: 74.964 N N N N
vg0305293070 C -> A LOC_Os03g10400.2 downstream_gene_variant ; 4264.0bp to feature; MODIFIER silent_mutation Average:47.547; most accessible tissue: Callus, score: 74.964 N N N N
vg0305293070 C -> A LOC_Os03g10380-LOC_Os03g10390 intergenic_region ; MODIFIER silent_mutation Average:47.547; most accessible tissue: Callus, score: 74.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305293070 NA 1.76E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0305293070 5.31E-06 NA mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 1.93E-06 2.59E-08 mr1246 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 NA 1.40E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 NA 1.09E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 7.08E-06 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 NA 1.16E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 NA 6.73E-14 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 NA 7.60E-07 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 6.93E-06 NA mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 1.73E-06 1.52E-08 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 NA 2.88E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305293070 NA 2.79E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251