\
| Variant ID: vg0305293070 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 5293070 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )
GTTTATAAACTAGACACACCCATCACATTTTATCAAACTCGTCCGATAAATTCGTGGCTAGCTACTCTCCCTGTCCCAAAATAAGACAAATCCTGGGTTT[C/A]
CGTGTCCAACATTTGACTGTATGTTTTATATGAAATATTTTTATAATTAGTATTTCCATTGTTGTTAGATGATAAAACATGATTAATACTTTATGCGTGA
TCACGCATAAAGTATTAATCATGTTTTATCATCTAACAACAATGGAAATACTAATTATAAAAATATTTCATATAAAACATACAGTCAAATGTTGGACACG[G/T]
AAACCCAGGATTTGTCTTATTTTGGGACAGGGAGAGTAGCTAGCCACGAATTTATCGGACGAGTTTGATAAAATGTGATGGGTGTGTCTAGTTTATAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 22.40% | 1.74% | 0.00% | NA |
| All Indica | 2759 | 59.40% | 37.70% | 2.90% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 26.60% | 65.70% | 7.73% | 0.00% | NA |
| Indica II | 465 | 37.00% | 60.00% | 3.01% | 0.00% | NA |
| Indica III | 913 | 89.20% | 10.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 63.00% | 34.90% | 2.16% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0305293070 | C -> A | LOC_Os03g10370.1 | upstream_gene_variant ; 2505.0bp to feature; MODIFIER | silent_mutation | Average:47.547; most accessible tissue: Callus, score: 74.964 | N | N | N | N |
| vg0305293070 | C -> A | LOC_Os03g10390.1 | upstream_gene_variant ; 1453.0bp to feature; MODIFIER | silent_mutation | Average:47.547; most accessible tissue: Callus, score: 74.964 | N | N | N | N |
| vg0305293070 | C -> A | LOC_Os03g10380.1 | downstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:47.547; most accessible tissue: Callus, score: 74.964 | N | N | N | N |
| vg0305293070 | C -> A | LOC_Os03g10400.2 | downstream_gene_variant ; 4264.0bp to feature; MODIFIER | silent_mutation | Average:47.547; most accessible tissue: Callus, score: 74.964 | N | N | N | N |
| vg0305293070 | C -> A | LOC_Os03g10380-LOC_Os03g10390 | intergenic_region ; MODIFIER | silent_mutation | Average:47.547; most accessible tissue: Callus, score: 74.964 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0305293070 | NA | 1.76E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0305293070 | 5.31E-06 | NA | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | 1.93E-06 | 2.59E-08 | mr1246 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | NA | 1.40E-06 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | NA | 1.09E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | 7.08E-06 | NA | mr1103_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | NA | 1.16E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | NA | 6.73E-14 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | NA | 7.60E-07 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | 6.93E-06 | NA | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | 1.73E-06 | 1.52E-08 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | NA | 2.88E-06 | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305293070 | NA | 2.79E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |